BBa_K1333004 1 BBa_K1333004 M13 bacteriophage g5p with a FLAG tag on C-terminal 2014-09-23T11:00:00Z 2015-05-08T01:09:57Z It is derived from the commercial M13KE vector(New England Biolabs) used in phage display system by PCR. This part is coding the M13 bacteriophage g5p with a FLAG tag on C-terminal, which could act as an single strand DNA binding protein and RNA binding protein at the same time. These properties make g5p protein an important regulatory protein for M13 phage. In the life cycle of M13 phage, g5p protein would bind to newly synthesized viral genome ssDNA, resulting in the correct direction to the phage packaging site. Also, g5p protein would repress the expression of g2p protein by binding to the leader sequence of viral mRNA. false false _1708_ 0 18998 9 In stock true Between the g5p and FLAG coding sequencing, there are 9 nucleotides linker sequence coding a 3 amino acid peptide. It is not certain whether this peptide would affect the regular function of g5p protein. false Huang Junxiang, Wang Xizi annotation2386062 1 g5p range2386062 1 1 261 annotation2386063 1 FLAG range2386063 1 271 297 BBa_K1333004_sequence 1 atgattaaagttgaaattaaaccatctcaagcccaatttactactcgttctggtgtttctcgtcagggcaagccttattcactgaatgagcagctttgttacgttgatttgggtaatgaatatccggttcttgtcaagattactcttgatgaaggtcagccagcctatgcgcctggtctgtacaccgttcatctgtcctctttcaaagttggtcagttcggttcccttatgattgaccgtctgcgcctcgttccggctaagagatcatcagactacaaagatgacgacgataaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z