BBa_I13453 1 BBa_I13453 Pbad promoter 2005-05-24T11:00:00Z 2015-08-31T04:07:34Z Released HQ 2013 PBad promoter from I0500 without AraC. false false _11_ 0 253 6 In stock false true jkm BBa_K1333304 1 BBa_K1333304 I13453-PrfA 2014-09-23T11:00:00Z 2015-05-08T01:09:58Z The source of the part will be its components. This part is a combination of a pBAD promoter(BBa_I13453), RNA thermometer(BBa_K115003) false false _1708_ 0 15873 9 In stock false false Runwen Yao component2385932 1 BBa_K115003 component2385929 1 BBa_I13453 annotation2385929 1 BBa_I13453 range2385929 1 1 130 annotation2385932 1 BBa_K115003 range2385932 1 139 247 BBa_K115003 1 BBa_K115003 RNA thermometer (PrfA) 2008-07-14T11:00:00Z 2015-05-08T01:09:27Z This sequence is taken from the Listeria Monocytogenes (EU372032.). It's the 5'UTR of a TF induced at 37 degrees. Released HQ 2013 This part is designed as a temperature inducible RBS. Only designed so far. false false _223_ 0 3007 9 In stock true The secondary structure is important to the function of these regions, but part of the wt secondary structure is destroyed by the scar. We've tried to alter the sequence so the predicted structure (through mfold and those kind of servers) is sort of conserved, but temperature sensitivity still has to be tested. If it doesn't work, possible solution might be the addition of a larger conserved part of the wt, which implies a small part of wt protein sequence as well. true O.M.J.A. Stassen annotation1966983 1 SD range1966983 1 106 109 annotation1967003 1 Predicted stem loop up to A of AUG range1967003 1 28 109 BBa_I13453_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagc BBa_K1333304_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagctactagagtgtaaaaaatattatttagcgtgactttctagtaacagctaacaattgttgttactgcctaatgtttttagggtattttaaaaaagggcgataaaaaacgattggggga BBa_K115003_sequence 1 tgtaaaaaatattatttagcgtgactttctagtaacagctaacaattgttgttactgcctaatgtttttagggtattttaaaaaagggcgataaaaaacgattggggga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z