BBa_I13453 1 BBa_I13453 Pbad promoter 2005-05-24T11:00:00Z 2015-08-31T04:07:34Z Released HQ 2013 PBad promoter from I0500 without AraC. false false _11_ 0 253 6 In stock false true jkm BBa_K115002 1 BBa_K115002 RNA thermometer (FourU) 2008-07-14T11:00:00Z 2015-05-08T01:09:27Z Salmonella Enterica Tyhpy (CP000886.1) Released HQ 2013 Thermo sensitive small RNA (ROSE structure) which can be used as a RNA regulator. false false _223_ 0 3006 9 In stock true Part of the sequence is altered because of the scar... true Bastiaan van den Berg annotation1966931 1 predicted stem-loop extending to one position before start codon range1966931 1 24 52 annotation1966897 1 rbs range1966897 1 47 52 annotation1966930 1 stem_loop range1966930 1 1 18 annotation1966899 1 scar adaptation range1966899 1 23 28 BBa_K1333305 1 BBa_K1333305 I13453-FourU 2014-09-23T11:00:00Z 2015-05-08T01:09:58Z The source of the part will be its components. This part is a combination of a pBAD promoter(BBa_I13453), RNA thermometer(BBa_K115002） false false _1708_ 0 15873 9 In stock false false Runwen Yao component2385939 1 BBa_I13453 component2385944 1 BBa_K115002 annotation2385939 1 BBa_I13453 range2385939 1 1 130 annotation2385944 1 BBa_K115002 range2385944 1 139 190 BBa_I13453_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagc BBa_K1333305_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagctactagagggacaagcaatgcttgccttgaatagtaacttttgaatagtgattcaggagg BBa_K115002_sequence 1 ggacaagcaatgcttgccttgaatagtaacttttgaatagtgattcaggagg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z