BBa_I13453 1 BBa_I13453 Pbad promoter 2005-05-24T11:00:00Z 2015-08-31T04:07:34Z Released HQ 2013 PBad promoter from I0500 without AraC. false false _11_ 0 253 6 In stock false true jkm BBa_K1333307 1 BBa_K1333307 I13453-PrfA-PⅧ 2014-09-23T11:00:00Z 2015-05-08T01:09:58Z false false _1708_ 0 15873 9 In stock false false Runwen Yao component2386237 1 BBa_K115003 component2386234 1 BBa_I13453 component2386240 1 BBa_K1333005 annotation2386237 1 BBa_K115003 range2386237 1 139 247 annotation2386240 1 BBa_K1333005 range2386240 1 254 508 annotation2386234 1 BBa_I13453 range2386234 1 1 130 BBa_K1333005 1 BBa_K1333005 M13 bacteriophage g8p with a FLAG tag on C-terminal 2014-09-23T11:00:00Z 2015-05-08T01:09:57Z pVIII with a FLAG tag on C-terminal pVIII with a FLAG tag on C-terminal false false _1708_ 0 15838 9 In stock true pVIII with a FLAG tag on C-terminal false Huang Junxiang, Wang Xizi annotation2386089 1 FLAG range2386089 1 229 255 annotation2386088 1 g8p range2386088 1 1 219 BBa_K115003 1 BBa_K115003 RNA thermometer (PrfA) 2008-07-14T11:00:00Z 2015-05-08T01:09:27Z This sequence is taken from the Listeria Monocytogenes (EU372032.). It's the 5'UTR of a TF induced at 37 degrees. Released HQ 2013 This part is designed as a temperature inducible RBS. Only designed so far. false false _223_ 0 3007 9 In stock true The secondary structure is important to the function of these regions, but part of the wt secondary structure is destroyed by the scar. We've tried to alter the sequence so the predicted structure (through mfold and those kind of servers) is sort of conserved, but temperature sensitivity still has to be tested. If it doesn't work, possible solution might be the addition of a larger conserved part of the wt, which implies a small part of wt protein sequence as well. true O.M.J.A. Stassen annotation1967003 1 Predicted stem loop up to A of AUG range1967003 1 28 109 annotation1966983 1 SD range1966983 1 106 109 BBa_I13453_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagc BBa_K115003_sequence 1 tgtaaaaaatattatttagcgtgactttctagtaacagctaacaattgttgttactgcctaatgtttttagggtattttaaaaaagggcgataaaaaacgattggggga BBa_K1333307_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagctactagagtgtaaaaaatattatttagcgtgactttctagtaacagctaacaattgttgttactgcctaatgtttttagggtattttaaaaaagggcgataaaaaacgattgggggatactagatgaaaaagtctttagtcctcaaagcctctgtagccgttgctaccctcgttccgatgctgtctttcgctgctgagggtgacgatcccgcaaaagcggcctttaactccctgcaagcctcagcgaccgaatatatcggttatgcgtgggcgatggttgttgtcattgtcggcgcaactatcggtatcaagctgtttaagaaattcacctcgaaagcaagcagatcatcagactacaaagatgacgacgataaatga BBa_K1333005_sequence 1 atgaaaaagtctttagtcctcaaagcctctgtagccgttgctaccctcgttccgatgctgtctttcgctgctgagggtgacgatcccgcaaaagcggcctttaactccctgcaagcctcagcgaccgaatatatcggttatgcgtgggcgatggttgttgtcattgtcggcgcaactatcggtatcaagctgtttaagaaattcacctcgaaagcaagcagatcatcagactacaaagatgacgacgataaatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z