BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_K115003 1 BBa_K115003 RNA thermometer (PrfA) 2008-07-14T11:00:00Z 2015-05-08T01:09:27Z This sequence is taken from the Listeria Monocytogenes (EU372032.). It's the 5'UTR of a TF induced at 37 degrees. Released HQ 2013 This part is designed as a temperature inducible RBS. Only designed so far. false false _223_ 0 3007 9 In stock true The secondary structure is important to the function of these regions, but part of the wt secondary structure is destroyed by the scar. We've tried to alter the sequence so the predicted structure (through mfold and those kind of servers) is sort of conserved, but temperature sensitivity still has to be tested. If it doesn't work, possible solution might be the addition of a larger conserved part of the wt, which implies a small part of wt protein sequence as well. true O.M.J.A. Stassen annotation1967003 1 Predicted stem loop up to A of AUG range1967003 1 28 109 annotation1966983 1 SD range1966983 1 106 109 BBa_E1010 1 mRFP1 **highly** engineered mutant of red fluorescent protein from Discosoma striata (coral) 2004-07-27T11:00:00Z 2015-08-31T04:07:26Z Campbell et al., PNAS v99 p7877 <a href="http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=12060735">URL</a> Released HQ 2013 monomeric RFP: Red Fluorescent Protein. Excitation peak: 584 nm Emission peak: 607 nm false false _11_1_ 0 52 7 In stock false TAATAA double stop codon added (DE). Four silent mutations made to remove three EcoRI sites and one PstI site: A28G, A76G, A349G, G337A. true Drew Endy annotation1014044 1 mrfp1 range1014044 1 1 675 annotation2214014 1 Help:Barcodes range2214014 1 682 706 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K1333311 1 BBa_K1333311 RFP with an RNA thermometer(PrfA) 2014-09-23T11:00:00Z 2015-05-08T01:09:58Z The RNAT comes from genomic sequence We add araBAD promoter up to this reporter part. false false _1708_ 0 15896 9 It's complicated false To regulate RFP expression with temperature on the translation level used RNAT. false Wei Tang component2386077 1 BBa_B0015 component2386070 1 BBa_E1010 component2386067 1 BBa_K115003 annotation2386077 1 BBa_B0015 range2386077 1 830 958 annotation2386070 1 BBa_E1010 range2386070 1 116 821 annotation2386067 1 BBa_K115003 range2386067 1 1 109 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1333311_sequence 1 tgtaaaaaatattatttagcgtgactttctagtaacagctaacaattgttgttactgcctaatgtttttagggtattttaaaaaagggcgataaaaaacgattgggggatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K115003_sequence 1 tgtaaaaaatattatttagcgtgactttctagtaacagctaacaattgttgttactgcctaatgtttttagggtattttaaaaaagggcgataaaaaacgattggggga BBa_E1010_sequence 1 atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z