BBa_K1334000 1 BBa_K1334000 A promoter activitated by formaldehyde. 2014-09-25T11:00:00Z 2015-05-08T01:09:58Z This part comes from the Bacillus subtilis genomic sequence. This promoter can sense the whether there is formaldehyde or not.It can be activitated by formaldehyde with the help of the protein hxlR.This promoter may have some leakage in the strain E.coli DH5a . false false _1709_ 0 22430 9 In stock false There may be different expression levels when you use it in different stains of E.coli. false Haoyuan Sun annotation2386999 1 rbs range2386999 1 215 222 annotation2387004 1 HxlR protein binding site 2 range2387004 1 151 175 annotation2387005 1 A theoretically promoter(very weak) range2387005 1 73 107 annotation2387002 1 Formaldehyde promoter range2387002 1 171 207 annotation2387003 1 HxlR protein binding site 1 range2387003 1 126 150 BBa_K1334000_sequence 1 tagaatcccccccttagtaacctttttgtatgttagatacgtatcatcacttacttacttttttgcagactcttttttcattatactcactcataaaatcaagcgaaagaaatctgattgtctctcctcacagtatcctccaagtaacttgttgacttcaaagtgcctacttctcaacaaaagaaggaacctatagaatgaacaataattcgaaaaagggagtggatcaac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z