BBa_K1334029 1 BBa_K1334029 HxlR protein coding sequence 2014-09-29T11:00:00Z 2015-05-08T01:09:58Z The genomic sequence of Bacillus subtilis 168. HxlR,a member of the DUF24 protein family,is a DNA-binding protein that acts as a positive regulator of the Formaldehyde Promoter. false false _1709_ 0 22430 9 Not in stock false In Bacillus subtilis 168,the start codon is UUG while in our part it is AUG. false Haoyuan Sun BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1334003 1 BBa_K1334003 RBS+HxlR protein 2014-09-26T11:00:00Z 2015-05-08T01:09:58Z The genomic sequence of Bacillus subtilis 168. HxlR,a member of the DUF24 protein family,is a DNA-binding protein that acts as a positive regulator of the Formaldehyde Promoter. false false _1709_ 0 22430 9 It's complicated false In Bacillus subtilis 168,the start codon is UUG while in our part it is AUG. false Haoyuan Sun component2390798 1 BBa_K1334029 component2390797 1 BBa_B0034 annotation2390797 1 BBa_B0034 range2390797 1 1 12 annotation2390798 1 BBa_K1334029 range2390798 1 21 383 BBa_K1334029_sequence 1 ttgagccggatggacgacaaaaggtttaattgtgagaaggaattaacgcttgcagtgattggcggtaaatggaaaatgctcattttatggcatttaggaaaagaaggcacaaaacggttcaatgaattaaaaacattgattcctgatattacgcagaagatcctcgtgaatcagctgagagagcttgagcaggatatgattgttcacagggaagtgtatccagttgtcccgccgaaggttgaatattctctgaccccgcacggagaaagcctcatgcctattcttgaagccatgtatgagtgggggaaaggctatatggaattgattgatatcgacaaaaatgtcatgaaagaatcgttgtaa BBa_B0034_sequence 1 aaagaggagaaa BBa_K1334003_sequence 1 aaagaggagaaatactagagttgagccggatggacgacaaaaggtttaattgtgagaaggaattaacgcttgcagtgattggcggtaaatggaaaatgctcattttatggcatttaggaaaagaaggcacaaaacggttcaatgaattaaaaacattgattcctgatattacgcagaagatcctcgtgaatcagctgagagagcttgagcaggatatgattgttcacagggaagtgtatccagttgtcccgccgaaggttgaatattctctgaccccgcacggagaaagcctcatgcctattcttgaagccatgtatgagtgggggaaaggctatatggaattgattgatatcgacaaaaatgtcatgaaagaatcgttgtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z