BBa_K1334027 1 BBa_K1334027 promoter similar to R0011 2014-09-28T11:00:00Z 2015-05-08T01:09:58Z tactaga is added to b0015 by PCR. B0015 with 7 nonsense base pair(tactaga) at the end of it. false false _1709_ 0 22430 9 Not in stock false tactaga is added for the convenience of the PCR of another reconstructed biobrick. false Haoyuan Sun BBa_K1334027_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatactaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z