BBa_K1334028 1 BBa_K1334028 IPTG activated promoter similar to R0011 2014-09-28T11:00:00Z 2015-05-08T01:09:58Z 7 nonsense base pair(tactaga) is added to the end of R0011 by PCR. 7 nonsense base pair(tactaga) is added to the end of R0011 to form this part. false false _1709_ 0 22430 9 Not in stock false 7 nonsense base pair(tactaga) is added to the end of R0011 to make it easier to PCR another biobrick. false Haoyuan Sun BBa_K1334028_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatactaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z