BBa_K1334029 1 BBa_K1334029 HxlR protein coding sequence 2014-09-29T11:00:00Z 2015-05-08T01:09:58Z The genomic sequence of Bacillus subtilis 168. HxlR,a member of the DUF24 protein family,is a DNA-binding protein that acts as a positive regulator of the Formaldehyde Promoter. false false _1709_ 0 22430 9 Not in stock false In Bacillus subtilis 168,the start codon is UUG while in our part it is AUG. false Haoyuan Sun BBa_K1334029_sequence 1 ttgagccggatggacgacaaaaggtttaattgtgagaaggaattaacgcttgcagtgattggcggtaaatggaaaatgctcattttatggcatttaggaaaagaaggcacaaaacggttcaatgaattaaaaacattgattcctgatattacgcagaagatcctcgtgaatcagctgagagagcttgagcaggatatgattgttcacagggaagtgtatccagttgtcccgccgaaggttgaatattctctgaccccgcacggagaaagcctcatgcctattcttgaagccatgtatgagtgggggaaaggctatatggaattgattgatatcgacaaaaatgtcatgaaagaatcgttgtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z