BBa_K1336001 1 BBa_K1336001 Azoreductase 1B6 (Heat-stable Azoreductase mutant) 2014-10-05T11:00:00Z 2015-05-08T01:09:58Z From genomic sequence of Pseudomonas putida; AzoR gene inserted into a pET-21a (+) expression vector, provided to us by XXX Research Group. A gene (612bp) coding for a non-specific enzyme from Pseudomonas putida that is used to degrade a double nitrogen (N=N) azo bond, as found in azo dyes. It is heat-stable AzoR mutant (BBa_K1336000). false false _1711_ 0 20842 9 Not in stock false When designing PCR primers to change the AzoR gene into the BioBrick format, we also had to design primers for site-directed mutagenesis, as there are 2 illegal PstI restriction sites within the native gene (at positions 89 and 170). false Yan-Kay Ho BBa_K1336001_sequence 1 atgaaactgttgcacatcgattcgagcatcctgggcgacaattccgcctcgcgccagctgagccgtgaagtggtcgaagcctggaaggctgcagacccaagcgtggaagtggtttatcgcgacctggctgccgatcccatcgcccacttctccgctgccaccctggtcgctgcaggcacccctgaagacgtacgcgacgcggcccaggctttcgaagccaagctgagcgccgagacgctcgaagagttcctggctgccgatggcgtggtgattggtgcgcccatgtacaacttcaccgtgccgacccagctcaaagcctggattgaccgcgtagccgtcgccggcaagaccttccgctacaccgaagccggcccgcaaggcctgagcggcgacaagaaagtggtgctggtttccactgcgggtggccagcatgctggccagccgactggcgccgggcatgaagacttcctgaaagcgttcctgggcttcatcgggattactgacctggaaatcgtccgggcccacggcctggactatggcccggagcagcgcagccaggcgatagatgctgcacgggcgcagattgccagcgagctgtttgcggctgcctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z