BBa_K1336005 1 BBa_K1336005 Antisense for octaprenyl diphosphate synthase (ispB gene) 2014-10-05T11:00:00Z 2015-05-08T01:09:58Z From genomic sequence of Escherichia coli. An antisense fragment designed using the sense/coding strand of the ispB gene as a method for gene knockdown (i.e. as RNAi) of a crucial stage in the production of quinones within E. coli metabolic processes. false false _1711_ 0 20842 9 In stock false When designing PCR primers to change the reverse complement sequence of the ispB gene into the BioBrick format, we truncated the fragment to avoid an illegal PstI restriction site (and so no extra primers were required for site-directed mutagenesis to remove illegal sites). false Yan-Kay Ho annotation2397291 1 antisense ispB coding region range2397291 1 1 562 BBa_K1336005_sequence 1 ggcctttctcctcctccggcgtacagccagccagaatcccggaacactgcgcggcagcctcaaacagacgcgcggttttgctatagataacgcgcatgtagttttcttcagtgatgtccggatcgttaacgttcatcagttgcagaacttcaccttctgcgatgacgtttacggcttctgacatgacttccagcactttgagcgaaccgaggctggtcatcatctggaaagcgcgggtataaataaaatcgcctaccagcacgctggcggcattgccaaatgcggcgttggcggtagctttacccctgcgcatatctgattcatccacaacgtcgtcgtgtagcagagtcgccgtgtggataaactcgatcagggcagcaatggtgacatgcgcatttccctcatagccaacagctcgtgcagccagtacagcaatcatcggacgaatacgtttaccgccgccgctgacgatgtaatagcctaactgattgatcagttggacgtcggaattaagctgctcaaggattgccgcattaacacccgccatatcttgcgcggttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z