BBa_K1343001 1 BBa_K1343001 P_ompC->NheI->RBS->luxI->double terminator 2014-09-21T11:00:00Z 2015-05-08T01:09:59Z P_ompC: BBa_R0082 RBS: BBa_B0030 luxI: BBa_C0061 but we removed the LVA tag (gctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc) and added stop codon: "tag". Double terminator BBa_B0015 This part generates AHL (Source organism: V. fischeri). The promoter is P_ompC which induced by the Taz receptor which is cloned on a different plasmid as a different patr. Before the promoter there is the prefix site and after the promoter there is a restriction site of NheI, so the promoter can be replaced by a restriction enzyme reaction. In addition, after the NheI restriction site, there is an RBS and luxI which is coding to AHL. At the end of the part, there is double terminator and the Suffix site. false false _1718_ 0 20568 9 It's complicated false The part has been sequenced and has been checked with a detector strain which detects AHL and produce color. We know for sure that it produces AHL. false Ronen Ben Jehuda annotation2384908 1 P_ompC range2384908 1 1 108 annotation2384921 1 luxI range2384921 1 141 722 annotation2384909 1 NehI range2384909 1 109 114 annotation2384920 1 spacer range2384920 1 115 140 annotation2384922 1 Double terminator range2384922 1 723 851 BBa_K1343001_sequence 1 tcccttgcatttacattttgaaacatctatagcgataaatgaaacatcttaaaagttttagtatcatattcgtgttggattattctgcatttttggggagaatggactgctagctttttattaaagaggagaaaccccccatgactataatgataaaaaaatcggattttttggcaattccatcggaggagtataaaggtattctaagtcttcgttatcaagtgtttaagcaaagacttgagtgggacttagttgtagaaaataaccttgaatcagatgagtatgataactcaaatgcagaatatatttatgcttgtgatgatactgaaaatgtaagtggatgctggcgtttattacctacaacaggtgattatatgctgaaaagtgtttttcctgaattgcttggtcaacagagtgctcccaaagatcctaatatagtcgaattaagtcgttttgctgtaggtaaaaatagctcaaagataaataactctgctagtgaaattacaatgaaactatttgaagctatatataaacacgctgttagtcaaggtattacagaatatgtaacagtaacatcaacagcaatagagcgatttttaaagcgtattaaagttccttgtcatcgtattggagacaaagaaattcatgtattaggtgatactaaatcggttgtattgtctatgcctattaatgaacagtttaaaaaagcagtcttaaattagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z