BBa_K592008 1 PT5lac T5-lac Promoter 2011-09-10T11:00:00Z 2015-05-08T01:12:48Z Phage T5 Released HQ 2013 T5-lac promoter is a hybrid promoter made from the phage T5 early promoter and lac-operon. It contains three LacI binding sites and remains repressed in LacIq strains where LacI is expressed in high levels. It is inducible by IPTG, and recognizable by E.coli RNA polymerase. Compared to the T7 promoters, T5-lac promoter doesn't require the co-expression of phage polymerase. false false _763_ 0 7929 9 In stock false The most common DH5alpha and TOP10 used in assembly are not LacI-constitutive (LacIq) strains. Thus, any ORF placed downstream to this promoter will be massively transcribed. Therefore, it's recommended to employ low-copy number plasmids or even LacIq strains when adding genes to this promoter. false Erik Lundin annotation2135661 1 -10 signal range2135661 1 87 93 annotation2127135 1 T5-lac promoter range2127135 1 1 126 annotation2135656 1 lacO1 site range2135656 1 1 26 annotation2135657 1 lacO1 site range2135657 1 69 86 annotation2135658 1 lacOi site range2135658 1 94 123 annotation2135659 1 -35 signal range2135659 1 63 68 BBa_K1344000 1 1018 1018 synthetic cationic peptide 2014-10-03T11:00:00Z 2015-05-08T01:10:00Z This part is synthetized. Peptide 1018 is a synthetic cationic peptides, derived from natural peptides such as the human cathelicidin LL-37 and the bovine peptide indolicidin. This part work as biofilm inhibitory compounds. Anti-biofilm peptides are similar to cationic antimicrobial peptides (which are active against planktonic bacteria), comprising both cationic and hydrophobic amino acids. false false _1719_ 0 20150 9 In stock true This part will have broad spectrum effect on gram-negative and gram-positive bacterias false UI Indonesia 2014 annotation2393869 1 1018 range2393869 1 1 45 annotation2393870 1 Stop range2393870 1 40 45 annotation2393871 1 ATG range2393871 1 1 1 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1344001 1 BBa_K1344001 T5-lac-1018 2014-10-04T11:00:00Z 2015-05-08T01:10:00Z 1018 is synthetized, and the promoter + rbs was taken from the registry, BBa_K592008 and BBa_B0034 This part will expressing 1018 by inducing IPTG at various concentration false false _1719_ 0 20150 9 It's complicated true This inhibitory and killing peptide will works only when induced with IPTG false UI Indonesia 2014 component2400459 1 BBa_K592008 component2400464 1 BBa_K1344000 component2400461 1 BBa_B0034 annotation2400459 1 BBa_K592008 range2400459 1 1 126 annotation2400461 1 BBa_B0034 range2400461 1 135 146 annotation2400464 1 BBa_K1344000 range2400464 1 153 197 BBa_B0034_sequence 1 aaagaggagaaa BBa_K1344000_sequence 1 atgcgtcgttggattcgtgttgctgttattctgcgcgtgtaataa BBa_K1344001_sequence 1 tgtggaattgtgagcggataacaattacgagcttcatgcacagtgaaatcatgaaaaatttatttgctttgtgagcggataacaattataatatgtggaattgtgagcgctcacaattccacaacgtactagagaaagaggagaaatactagatgcgtcgttggattcgtgttgctgttattctgcgcgtgtaataa BBa_K592008_sequence 1 tgtggaattgtgagcggataacaattacgagcttcatgcacagtgaaatcatgaaaaatttatttgctttgtgagcggataacaattataatatgtggaattgtgagcgctcacaattccacaacg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z