BBa_K1344000 1 1018 1018 synthetic cationic peptide 2014-10-03T11:00:00Z 2015-05-08T01:10:00Z This part is synthetized. Peptide 1018 is a synthetic cationic peptides, derived from natural peptides such as the human cathelicidin LL-37 and the bovine peptide indolicidin. This part work as biofilm inhibitory compounds. Anti-biofilm peptides are similar to cationic antimicrobial peptides (which are active against planktonic bacteria), comprising both cationic and hydrophobic amino acids. false false _1719_ 0 20150 9 In stock true This part will have broad spectrum effect on gram-negative and gram-positive bacterias false UI Indonesia 2014 annotation2393869 1 1018 range2393869 1 1 45 annotation2393870 1 Stop range2393870 1 40 45 annotation2393871 1 ATG range2393871 1 1 1 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1344007 1 BBa_K1344007 Thermo-regulated 1018 2014-10-04T11:00:00Z 2015-05-08T01:10:00Z This part is composite from the Registry This part expressing Peptide 1018 with temperature translational regulation by its RBS (ROSE 42C) false false _1719_ 0 20150 9 It's complicated false This part will make the killing and inhibitory Peptide 1018 regulated by the temperature false UI Indonesia 2014 component2394151 1 BBa_J23100 component2394158 1 BBa_K115008 component2394161 1 BBa_K1344000 annotation2394151 1 BBa_J23100 range2394151 1 1 35 annotation2394158 1 BBa_K115008 range2394158 1 44 139 annotation2394161 1 BBa_K1344000 range2394161 1 146 190 BBa_K115008 1 BBa_K115008 RNA thermometer (ROSE) 2008-08-17T11:00:00Z 2015-05-08T01:09:28Z This sequence is taken from the Bradirhizobium Japonicum (BA000040.) as the 5'UTR (ROSE) of a heat shock protein. This is a RNA-thermometer derived from ROSE (BBa_K115001), to check effect of small changes in RNA-sequence on temperature sensitivity false false _223_ 0 3007 9 In stock true A few nucleotides have been altered true O.M.J.A. Stassen annotation1971994 1 Predicted stem loop extending to start codon range1971994 1 71 96 annotation1971993 1 Predicted stem loop range1971993 1 38 71 annotation1971991 1 Predicted stem loop range1971991 1 1 15 annotation1971995 1 SD range1971995 1 89 95 annotation1971992 1 Predicted stem loop range1971992 1 15 36 annotation1971996 1 Scar adaptation range1971996 1 74 80 BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_K1344000_sequence 1 atgcgtcgttggattcgtgttgctgttattctgcgcgtgtaataa BBa_K1344007_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagaggccgcgacaagcggtccgggcgccctaggggcccggcggagacgggcgccggaggtgtccgacgcctgctcgtcaagtacttgctccttggaggattactagatgcgtcgttggattcgtgttgctgttattctgcgcgtgtaataa BBa_K115008_sequence 1 gccgcgacaagcggtccgggcgccctaggggcccggcggagacgggcgccggaggtgtccgacgcctgctcgtcaagtacttgctccttggaggat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z