BBa_K135000 1 BBa_K135000 pCpxR (CpxR responsive promoter) 2008-10-19T11:00:00Z 2015-05-08T01:10:01Z This part comes from the genome of E.coli TR235, as used in the PNAS paper of Otto and Silhavy mentioned previously. TR235 is K-12 MC4100 containing a pCpxR-LacZ fusion inserted at the (Lambda)att site, plus some other modifications (see Otto and Silhavy). The part is a portion of the CpxR responsive region used in these LacZ fusions. This is suggested to be an adhesion responsive promoter. It contains the binding site for CpxR-P (phosphorylated CpxR). CpxR is one member of the two-component Cpx response to envelope stress. Briefly, envelope stress causes CpxA, an inner-membrane histidine Kinase to Phosphorylate CpxR, allowing it to bind to CpxR-P responsive regions and regulate downstream target genes. See 'Surface sensing and adhesion of Escherichia coli controlled by the Cpx-signaling pathway', Karen Otto and Thomas J. Silhavy, PNAS, Vol. 99., No, 4., 2287-2292. 2002. false false _183_ 0 2796 9 It's complicated false None false Oliver Purcell annotation1982751 1 CpxR-P Binding site range1982751 1 1 15 annotation1982752 1 BBa_K135000 range1982752 1 1 55 BBa_K135000_sequence 1 gtaaaacaacgtaaagtcatggattagcgacgtctgatgacgtaatttctgcctc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z