BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0033 1 BBa_B0033 RBS.4 (weaker) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weaker RBS based on Ron Weiss thesis. Strengths relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-3&quot; in figure 4-14 of thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1713 1 RBS-4\Weaker range1713 1 1 11 annotation7028 1 BBa_B0033 range7028 1 1 11 annotation1714 1 RBS range1714 1 7 10 BBa_K581008 1 BBa_K581008 RBS+ccdB+Termintor 2011-09-25T11:00:00Z 2015-07-09T12:57:45Z Escherichia coli. Released HQ 2013 This is the cell death protein coding sequence under the control of a relatively weak RBS. It is replicable in non-ccdB resistant strains. true false _752_ 4206 8589 9 In stock false Use a relatively weak RBS so the coding sequence would be replicable in non-ccdB resistant strains under the putative promoter in VF region. false Deng Linna component2143057 1 BBa_K145151 component2143052 1 BBa_B0033 component2143064 1 BBa_B0015 annotation2143052 1 BBa_B0033 range2143052 1 1 11 annotation2143057 1 BBa_K145151 range2143057 1 18 323 annotation2143064 1 BBa_B0015 range2143064 1 332 460 BBa_K145151 1 ccdB ccdB coding region 2008-08-06T11:00:00Z 2015-07-08T03:14:50Z P1010 Released HQ 2013 Coding region for the ccdB (control of cell death) gene. true false _257_ 4206 2970 9 In stock true just one stop codon in the end true Jonas Demeulemeester annotation1970251 1 start range1970251 1 1 3 annotation1970252 1 stop range1970252 1 304 306 annotation1970253 1 cds range1970253 1 1 303 BBa_K1350000 1 BBa_K1350000 Ccdb E.coli suicide IPTG 2014-09-26T11:00:00Z 2015-05-08T01:10:01Z "IPTG bomb" kill the E.coli by coding Ccdb toxin protein. The Ccdb come from BBa_K581008(RBS+ccdB+Termintor),and T5-lac Promoter from BBa_K592008 A system designed to kill E.coli when IPTG added . IPTG can efficiently trigger a large numumber of Ccdb protein .And Ccdb protein a can combine with E.coli &#65292;So it can effectively kill the E.coli. false false _1725_ 0 20427 9 It's complicated false We have been thinking of a way, that way we could eliminate E.coli. Now we Ccdb protein-bound T5-lac and make the controls to suit our needs. false JieRui Chen component2387309 1 BBa_K581008 component2387294 1 BBa_K592008 annotation2387294 1 BBa_K592008 range2387294 1 1 126 annotation2387309 1 BBa_K581008 range2387309 1 135 594 BBa_K592008 1 PT5lac T5-lac Promoter 2011-09-10T11:00:00Z 2015-05-08T01:12:48Z Phage T5 Released HQ 2013 T5-lac promoter is a hybrid promoter made from the phage T5 early promoter and lac-operon. It contains three LacI binding sites and remains repressed in LacIq strains where LacI is expressed in high levels. It is inducible by IPTG, and recognizable by E.coli RNA polymerase. Compared to the T7 promoters, T5-lac promoter doesn't require the co-expression of phage polymerase. false false _763_ 0 7929 9 In stock false The most common DH5alpha and TOP10 used in assembly are not LacI-constitutive (LacIq) strains. Thus, any ORF placed downstream to this promoter will be massively transcribed. Therefore, it's recommended to employ low-copy number plasmids or even LacIq strains when adding genes to this promoter. false Erik Lundin annotation2135658 1 lacOi site range2135658 1 94 123 annotation2135659 1 -35 signal range2135659 1 63 68 annotation2135656 1 lacO1 site range2135656 1 1 26 annotation2135657 1 lacO1 site range2135657 1 69 86 annotation2127135 1 T5-lac promoter range2127135 1 1 126 annotation2135661 1 -10 signal range2135661 1 87 93 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0033_sequence 1 tcacacaggac BBa_K145151_sequence 1 atgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataa BBa_K1350000_sequence 1 tgtggaattgtgagcggataacaattacgagcttcatgcacagtgaaatcatgaaaaatttatttgctttgtgagcggataacaattataatatgtggaattgtgagcgctcacaattccacaacgtactagagtcacacaggactactagatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K581008_sequence 1 tcacacaggactactagatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K592008_sequence 1 tgtggaattgtgagcggataacaattacgagcttcatgcacagtgaaatcatgaaaaatttatttgctttgtgagcggataacaattataatatgtggaattgtgagcgctcacaattccacaacg BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z