BBa_K1350001 1 BBa_K1350001 A kind of secretory protein named kil 2014-09-26T11:00:00Z 2015-05-08T01:10:01Z ATGAGGAAAAGATTTTTTGTGGGAATATTCGCGATAAACCTCCTTGTTGGATGTCAGGCTAACTATATACCTGATGTTCAGGGAGGGACCATCGCACCATCCTCCTCTTCTAAACTGACGGGGATCGCGGTTCAGTAG fasta form&#65306; MRKRFFVGIF AINLLVGCQA NYIPDVQGGT IAPSSSSKLT GIAVQ This is a part.Its sequence length is 136bp and it begins with ATG.It will express the protein, and role in the periplasmic space of e. coli. false false _1725_ 0 20403 9 It's complicated true This sequence is little short. It might be confused with primer dimers after PCR, so your primer designing should be reasonable. false Yongyi Wang BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J23104 1 BBa_J23104 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z isolated from library of promoters replace later false false _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1350002 1 BBa_K1350002 Promotor+RBS(BBa_K608002) + kil protein(BBa_K1350001) 2014-09-26T11:00:00Z 2015-05-08T01:10:01Z BBa_K608002 This type is a device combined with a strong promoter and strong RBS.It dose not need to be artificially induced can start downstream gene kil gene transcription and expression. false false _1725_ 0 20403 9 It's complicated false If you need to use the device, it should be connected to a terminator in its downstream before you connect an exogenous gene. false Yongyi Wang component2387756 1 BBa_K1350001 component2387755 1 BBa_K608002 annotation2387756 1 BBa_K1350001 range2387756 1 62 199 annotation2387755 1 BBa_K608002 range2387755 1 1 55 BBa_K608002 1 BBa_K608002 strong Promoter and strong RBS 2011-09-14T11:00:00Z 2015-05-08T01:12:52Z assembly from iGEM parts Released HQ 2013 you can insert your part behind this part so it will be immediatly expressed in e.coli. false false _780_ 0 9115 9 In stock false cloning via 3a-assembly false Julia M??ller component2128646 1 BBa_J23104 component2128648 1 BBa_B0034 annotation2128646 1 BBa_J23104 range2128646 1 1 35 annotation2128648 1 BBa_B0034 range2128648 1 44 55 BBa_K1350002_sequence 1 ttgacagctagctcagtcctaggtattgtgctagctactagagaaagaggagaaatactagatgaggaaaagattttttgtgggaatattcgcgataaacctccttgttggatgtcaggctaactatatacctgatgttcagggagggaccatcgcaccatcctcctcttctaaactgacggggatcgcggttcagtag BBa_B0034_sequence 1 aaagaggagaaa BBa_K608002_sequence 1 ttgacagctagctcagtcctaggtattgtgctagctactagagaaagaggagaaa BBa_K1350001_sequence 1 atgaggaaaagattttttgtgggaatattcgcgataaacctccttgttggatgtcaggctaactatatacctgatgttcagggagggaccatcgcaccatcctcctcttctaaactgacggggatcgcggttcagtag BBa_J23104_sequence 1 ttgacagctagctcagtcctaggtattgtgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z