BBa_K1351004 1 BBa_K1351004 SigD-dependent promoter of the LytABC locus (PlytA) of Bacillus subtilis 2014-10-04T11:00:00Z 2015-06-01T08:15:05Z This part was generated by amplification from ''B. subtilis'' W168 gDNA with the primers listed below, followed by digestion with EcoRI and PstI and ligation into pSB1C3. PlytA_ENX_fwd: TGCAGAATTCGCGGCCGCTTCTAGAG ctcatcctttgcacctcg PlytA_SNP_rev: AGCCTGCAGCGGCCGCTACTAGTA tcattatattttatcgtcaacctatt PlytA promoter of the ''B. subtilis'' LytABC operon, under the control of SigD (major), the transcripts being predominants at the exponential growth phase, and SigA (minor). false false _1726_ 4206 20048 9 In stock false to be filled false Mona Dotzler annotation2394209 1 -10 range2394209 1 161 168 annotation2394208 1 -35 range2394208 1 143 146 BBa_K1351004_sequence 1 ctcatcctttgcacctcgtctgttaaattactttcattatgagttaaatttccaataaatacaactctatttaatacaagaatgaaatcctaaaatagtcgttttttataaaaaaaagtttcattgtttcttaatttttctttaaaatataaaataggttgacgataaaatataatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z