BBa_K1351017 1 BBa_K1351017 SdpI with RBS: Immunity against the cannibalsim toxin sdpC of <i>B. subtilis</i> 2014-09-08T11:00:00Z 2015-06-01T08:18:37Z The sequence comes from a PCR with B. subtilis gDNA template. This gene codes for the immunity against a cannibalism toxin of Bacillus subtilis namely the sdpC. The sdpI gene is regulated by a separate promoter (PsdpIR) which is responsible for the operon sdpIR. Cannibalsim toxins are mainly produced by b. subtilis in mid to late stationary phase when nutrients are limited. false false _1726_ 4206 20046 9 In stock true No changes were preformed regarding the sequence referring to the bio brick standard. false Philipp Popp & Roman Herzog annotation2382809 1 cds range2382809 1 1 333 BBa_K1351017_sequence 1 atgacgggtttagtcggcggagggcttatgatcattgcgggcatactgatcaaactgtttcctcccaaatcgatcaacagtgtgtacggatacagaacgagacgctcaatgtcagatcaaagattatggaatgaagcgaaccgttacagtgcatcattaatgatcctgtcaggcttggtgattgcgggaatgggtttgctgctgggatcaaacttgtttattcttcagcttatcctgctgattgccgcctgtgtcataacatttatgctaacggagaaaaggctgaaaatcatgacgcacagtcaaggaggagatagaagtggacggagttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z