BBa_K1351019 1 BBa_K1351019 Reverse complementary RNA sequence which binds the mRNA of the SdpI immunity 2014-09-30T11:00:00Z 2015-05-08T01:10:01Z Artificially ordered Artificial constructed complementary RNA which should bind the mRNA of the SdpI immunity protein in bacillus subtilis in order to disturb the protein biosynthesis. Expected was a loss of immunity in b. subtilis against its own cannibalism toxin SdpABC over time. false false _1726_ 0 20046 9 In stock false None false Philipp Popp BBa_K1351019_sequence 1 atgacgggtttagtcggcggagggcttatgatcattgcgggcatactgatcaaactgtttcctcccaaatcgatcaacagtgtgtacggatacagaacgagacgctcaatgtcagatcaaagattatggaatgaagcgaaccgttacagtgcatcattaatgatcctgtcaggcttggtgattgcgggaatgggtttgctgctgggatcaaacttgtttattcttcagcttatcctgctgattgccgcctgtgtcataacatttatgctaacggagaaaaggctgaaaatcatgacgcacagtcaaggaggagatagaagtggacggagttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z