BBa_K1351027 1 BBa_K1351027 Signal peptide of B. subtilis minor autolysin LytE 2014-10-04T11:00:00Z 2015-06-01T12:56:24Z This part was generated by amplification from BioBrick [http://parts.igem.org/Part:BBa_K1351007 BBa_K1351007] with the primers listed below, followed by digestion with EcoRI and PstI and ligation into pSB1C3. <br> LytE_ENX_SD_Ngo_fwd: gatcGAATTCgcggccgctTCTAGAgtaaggaggaaGCCGGC ATGAAAAAGCAAATCATTACAGCTACGACAGC <br> LyteSP_SNP_Age_rev: gatcCTGCAGcggccgctACTAGTattaACCGGT TGCAGATGCCGCTCCTGCAAATAAC Signal peptide (amino acids 1 to 25) of ''Bacillus subtilis'' minor autolysin LytE (probable peptidoglycan endopeptidase, Uniprot [http://www.uniprot.org/uniprot/P54421 P54421]). Targets proteins for secretion via the Sec pathway (Tjalsma ''et. al.'', 2000). This part was generated in a modified version of RFC25, where a strong Shine Dalgarno Sequence (SD) is included, and has the following prefix and suffix: {| |prefix with EcoRI, NotI, XbaI, SD and NgoMIV: |<span style="color:blue">GAATTC</span><span style="color:green">GCGGCCGC</span>T<span style="color:red">TCTAGA</span>GT<u>AAGGAGG</u>A<span style="color:orange">GCCGGC</span> |- |suffix with AgeI, SpeI, NotI and PstI: |<span style="color:orange">ACCGGT</span><u>TAA</u>T<span style="color:red">AC<u>TAG</u><u>T</u></span><u>A</u><span style="color:green"><u>G</u>CGGCCGC</span><span style="color:blue">CTGCAG</span> |} Sites of restriction enzymes generating compatible overhangs have the same color: <span style="color:blue">EcoRI</span> and <span style="color:blue">PstI</span> in blue, <span style="color:green">NotI</span> in green, <span style="color:red">XbaI</span> and <span style="color:red">SpeI</span> in red, <span style="color:orange">NgoMIV</span> and <span style="color:orange">AgeI</span> in orange. Shine-Dalgarno sequence and stop codons are underlined. false false _1726_ 4206 20048 9 In stock false none false Mona Dotzler BBa_K1351027_sequence 1 atgaaaaagcaaatcattacagctacgacagcagttgttttaggatcgacgttatttgcaggagcggcatctgca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z