BBa_K1351037 1 BBa_K1351037 P2-promoter 2014-10-05T11:00:00Z 2015-06-01T08:13:59Z artificially synthesized Quorum sensing dependant promotor (AIP II). Regulated by phosphorylated AgrA. Contains four AgrA binding sites upstream. false false _1726_ 4206 20162 9 In stock false Mutated illegal restriction sites. These sites have been mutated with regard to the codon usage of Bacillus subtilis. false Nikolai Peschek annotation2421817 1 AgrA box (binding site) range2421817 1 97 100 annotation2421819 1 -35 range2421819 1 130 136 annotation2421815 1 AgrA box (binding site) range2421815 1 22 29 annotation2421820 1 -10 range2421820 1 156 161 annotation2421816 1 AgrA box (binding site) range2421816 1 44 51 annotation2421818 1 AgrA box (binding site) range2421818 1 114 121 BBa_K1351037_sequence 1 gcatttattttccaatttttcttaactagacgttttttattcttaactgtaaatttttttatgttaaaatattaaatacaaattacatttaacagttaagtatttatttcctacagttaggcaatataatgataaaagattgtactaaatcgtataataacagtgagg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z