BBa_K1351038 1 BBa_K1351038 P3-promoter 2014-10-05T11:00:00Z 2015-06-01T08:14:22Z artificially synthesized Quorum sensing dependant promotor (AIP II). Regulated by phosphorylated AgrA. Contains four AgrA binding sites upstream. false false _1726_ 4206 20162 9 In stock false Several mutated illegal restriction sites. The mutated codons have been optimized regarding the codon usage of Bacillus subtilis. false Nikolai Peschek annotation2421886 1 AgrA box (binding site) range2421886 1 44 51 annotation2421887 1 AgrA box (binding site) range2421887 1 97 100 annotation2421889 1 -35 range2421889 1 133 138 annotation2421890 1 -10 range2421890 1 160 165 annotation2421888 1 AgrA box (binding site) range2421888 1 114 121 annotation2421885 1 AgrA box (binding site) range2421885 1 22 29 BBa_K1351038_sequence 1 gtacaatcttttatcattatattgcctaactgtaggaaataaatacttaactgttaaatgtaatttgtatttaatattttaacataaaaaaatttacagttaagaataaaaaacgtctagttaagaaaaattggaaaataaatgcttttagcatgttttaatataactagatcacagag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z