BBa_K1351039 1 BBa_K1351039 P_<i>xylA</i>, a xylose inducible promoter for <i>Bacillus subtilis</i> 2014-10-16T11:00:00Z 2015-06-01T08:15:51Z The part was generated by PCR from genomic DNA of ''B. subtilis'' W168. P_''xylA'' is the native promoter of the ''Bacillus subtilis'' xylose degradation locus ''xyl''. The promoter is regulated by the repressor XylR which is not encoded by this BioBrick. The regulation of P_''xylA'' is only ensured, if you are working with ''B. subtilis'' as a chassis. false false _1726_ 4206 6378 9 Not in stock false This is an inducible promoter for Bacillus subtilis. false Jara Radeck annotation2425215 1 XylR binding site range2425215 1 187 206 annotation2425214 1 -10 range2425214 1 164 172 BBa_K1351039_sequence 1 aaggccaaaaaactgctgccttcggatcagcgatatccacttcatccactccatttgtttaatctttaaattaagtatcaacatagtacatagcgaatcttccctttattatatctaatgtgttcataaaaaactaaaaaaaatattgaaaatactgacgaggttatataagatgaaaataagttagtttgtttaaacaacaaactaataggtgatgtacttactatatgaaataaaatgcatctgggatcccaagcttatcgaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z