BBa_K1355001 1 BBa_K1355001 Regulation and transport of mercury ions 2014-10-05T11:00:00Z 2015-07-23T04:05:30Z This construction is based on sequences present in the O26-CRL plasmid found in Escherichia coli O26. We added a reverse tryptophan operon terminator to ensure transcription termination of the merR messenger RNA. However we didn???t add transcription terminator after the merP gene, aiming connect this biobrick with others, enabling various functions related to mercury We call this part an ???Essential biobrick??? designed to be the key piece of any genetic construction related to mercury, targeting both a biosensor as a bioaccumulative. This biobrick has bidirectional promoter, the regulator MerR with a terminator reverse from the tryptophan operon and a forward MerP and MerT transporters. false false _1731_ 4206 15499 9 In stock true If is desirable to accumulate mercury, assemble this biobrick with a good RBS, a coding sequence of a peptide having affinity to metal and a terminator! Its function will be regulated by presence of mercury through MerR regulator. The bacteria will carry the mercury to cytoplasm until it is linked to the peptide having affinity to the metal, making a inactive mercury. Is not it amazing? This is the strategy that we use in our project! The so called ???Essential Biobrick??? was connected to biobrick for bioremediation, bioaccumulation and bio-detection! false Luna Barroco de Lacerda annotation2415749 1 RBS range2415749 1 490 496 annotation2415134 1 Bidirecional promoter range2415134 1 510 538 annotation2415752 1 RBS range2415752 1 537 543 annotation2415141 1 MerT range2415141 1 551 900 annotation2415126 1 MerR range2415126 1 44 480 annotation2415143 1 RBS range2415143 1 901 907 annotation2415127 1 Bidirecional promoter range2415127 1 486 514 annotation2397153 1 Trp Terminator range2397153 1 1 43 annotation2415155 1 MerP range2415155 1 914 1189 BBa_K1355001_sequence 1 aaagaaagttaaaatgccgccagcggaactggcggctgtgggactaaggcatagctgaccttgccaggcctgcttcgccctgtagtgacgcgatcaacgggcaggaaacattcccctttcgtgcatggcaggcgcacacgagttcagacagcacggtttccatgcgcgccaagtcggccatcttctcgcgcacgtccttgagcttgtgttcggccaggctgctggcctcctcgcagtgggtgccatcgtcgagccgcaacagctcggcaatctcgtccagactgaaccccagccgctgtgccgatttcacgaatttcacccgaaccacgtccgcctccccatagcggcggatgctgccgtaaggcttgtccggttcccgcaacaggcccttgcgctgatagaagcggattgtctccacgttgaccccggccgccttggcaaaaacgccaatggtcaggttttccaaattattttccatatcgcttgactccgtacatgagtacggaagtaaggttacgctatccaatccaaattcaaaagggccaacgtatgtctgaaccacaaaacgggcgcggtgcgctcttcgccggcgggctggccgccattcttgcatcgacctgctgcctggggccgctagtactggtcgccctgggcttctccggtgcttggatcggcaacctgacggtgctggaaccctatcgaccgttgttcatcggcgcggcgctagtggcgctgttcttcgcctggaagcggatttaccggcccgtgcaggcatgcaagccaggtgaggtctgcgcgattccgcaggtgcgcgccacctacaagctgattttctggatcgtggccgtgctggtcctggtcgcgcttggatttccctatgtcgttccatttttctattaaccaggagttcatcatgaagaaactgtttgcctcccttgccctcgccgccgctgttgccccggtgtgggccgctacccagaccgtcacgctagcggttcccggcatgacttgcgccgcctgcccgatcacagtcaagaaagcgctctccaaggtcgaaggcgtgagcaaggtcgatgtgggcttcgagaagcgcgaggccgtcgtcacttttgacgacaccaaggccagcgtacagaagctgaccaaggccaccgcagacgccggctatccgtccagcgtcaagcagtga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z