BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1690 1 polya range1690 1 28 41 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1357006 1 BBa_K1357006 Manganese Peroxidase Expression Vector 2014-10-08T11:00:00Z 2015-05-08T01:10:02Z Commercially sequenced but amino acid sequence taken from Phanerochaete chrysosporium. Manganese peroxidase (MnP) is an enzyme from the fungus, Phanerochaete chrysosporium. This enzyme has been shown to degrade nylon 6 and nylon 66. The sequence for MnP in this BioBrick has been codon optimized for E.coli. A pelB secretion tag was also attached to the MnP sequence. The BioBrick also contains a constitutive promoter, a ribosome binding site and a terminator. This BioBrick allows E.coli to secrete manganese peroxidase into the surrounding environment. false false _1733_ 0 16772 9 It's complicated false The coding gene sequence is optimized for expression in E. coli false Matthew Tucker component2408671 1 BBa_K1357001 component2408678 1 BBa_B0015 component2408668 1 BBa_J23100 component2408670 1 BBa_B0034 annotation2408668 1 BBa_J23100 range2408668 1 1 35 annotation2408670 1 BBa_B0034 range2408670 1 44 55 annotation2408671 1 BBa_K1357001 range2408671 1 64 1202 annotation2408678 1 BBa_B0015 range2408678 1 1211 1339 BBa_K1357001 1 BBa_K1357001 Manganese Peroxidase With pelB Secretion Tag 2014-10-05T11:00:00Z 2015-05-08T01:10:02Z Taken from Phanerochaete chrysosporium This part contains the coding sequence for the enzyme Mangaenese Peroxidase (MnP) as well as the secretion tag pelB. Manganese peroxidase is an enzyme from the fungus, Phanerochaete chrysosporium. In this fungus, commonly known as white rot fungus, this enzyme aids in lignin degradation. This enzyme has been shown to degrade nylon 6 and nylon 66. The sequence for MnP in this BioBrick has been codon optimized for E.coli. A pelB secretion tag was also attached to the MnP sequence. It is intended for use by teams that are exploring plastic degradation in their research. Enzymatic activity requires a pH near 4.5 as well as a manganese source such as manganese sulphate. Works best at temperatures near 32 C. Related genes include nylC, nylon hydrolaze, which is also used to degrade nylon plastics. false false _1733_ 0 16772 9 In stock false E. coli optimized and no illegal cutsites false Matthew Tucker BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1357006_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagaaagaggagaaatactagagtgaaatacctgctgccgaccgctgctgctggtctgctgctcctcgctgcccagccggcgatggccgcggtttgcccggacggtacccgtgtttctcacgcggcgtgctgcgcgttcatcccgctggcgcaggacctacaagaaaccatcttccagaacgaatgcggtgaagacgcgcacgaagttatccgtctgaccttccacgacgcgatcgcgatctctcgttctcagggtccgaaagcgggtggtggtgcggacggttctatgctgctgttcccgaccgttgaaccgaacttctctgcgaacaacggtatcgacgactctgttaacaacctgatcccgttcatgcagaaacacaacaccatctctgcggcggacctggttcagttcgcgggtgcggttgcgctgtctaactgcccgggtgcgccgcgtctggaatttctggcgggtcgtccgaacaaaaccgttgcggcggttgacggtctgatcccggaaccgcaggactctgttaccaaaatcctgcaacgtttcgaagacgcgggtggtttcaccccgttcgaagttgtttctctgctggcgtctcactctgttgcgcgtgcggacaaagttgaccagaccatcgacgcggcgccgttcgactctaccccgttcaccttcgacacccaggttttcctggaagttctgctgaaaggtgttggtttcccgggttctgcgaacaacaccggtgaagttgcgtctccgctgccgctgggttctggttctgacaccggtgaaatgcgtcttcagtctgacttcgcgctggcgcacgacccgcgtaccgcgtgcatctggcagggtttcgttaacgaacaggcgttcatggcggcgtctttccgtgcggcgatgtctaaactggcggttctgggtcacaaccgtaactctctgatcgactgctctgacgttgttccggttccgaaaccggcgaccggtcagccggcgatgttcccggcgtctaccggtccgcaggacctggaactgtcttgcccgtctgaacgtttcccgaccctgaccacccagccgggtgcgtctcagtctctgatcgcgcactgcccggacggttctatgtcttgcccgggtgttcagttcaacggtccggcgtaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1357001_sequence 1 atgaaatacctgctgccgaccgctgctgctggtctgctgctcctcgctgcccagccggcgatggccgcggtttgcccggacggtacccgtgtttctcacgcggcgtgctgcgcgttcatcccgctggcgcaggacctacaagaaaccatcttccagaacgaatgcggtgaagacgcgcacgaagttatccgtctgaccttccacgacgcgatcgcgatctctcgttctcagggtccgaaagcgggtggtggtgcggacggttctatgctgctgttcccgaccgttgaaccgaacttctctgcgaacaacggtatcgacgactctgttaacaacctgatcccgttcatgcagaaacacaacaccatctctgcggcggacctggttcagttcgcgggtgcggttgcgctgtctaactgcccgggtgcgccgcgtctggaatttctggcgggtcgtccgaacaaaaccgttgcggcggttgacggtctgatcccggaaccgcaggactctgttaccaaaatcctgcaacgtttcgaagacgcgggtggtttcaccccgttcgaagttgtttctctgctggcgtctcactctgttgcgcgtgcggacaaagttgaccagaccatcgacgcggcgccgttcgactctaccccgttcaccttcgacacccaggttttcctggaagttctgctgaaaggtgttggtttcccgggttctgcgaacaacaccggtgaagttgcgtctccgctgccgctgggttctggttctgacaccggtgaaatgcgtcttcagtctgacttcgcgctggcgcacgacccgcgtaccgcgtgcatctggcagggtttcgttaacgaacaggcgttcatggcggcgtctttccgtgcggcgatgtctaaactggcggttctgggtcacaaccgtaactctctgatcgactgctctgacgttgttccggttccgaaaccggcgaccggtcagccggcgatgttcccggcgtctaccggtccgcaggacctggaactgtcttgcccgtctgaacgtttcccgaccctgaccacccagccgggtgcgtctcagtctctgatcgcgcactgcccggacggttctatgtcttgcccgggtgttcagttcaacggtccggcgtaa BBa_B0034_sequence 1 aaagaggagaaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z