BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_K1357008 1 BBa_K1357008 tsPurple Reporter (RBS + Coding + Terminator) 2014-10-08T11:00:00Z 2015-05-08T01:10:02Z Coding sequence comes from jellyfish? Reporter to add onto parts to see if they are functional false false _1733_ 0 16772 9 In stock false None false Matthew Tucker component2408700 1 BBa_B0015 component2408691 1 BBa_B0034 component2408693 1 BBa_K1033906 annotation2408693 1 BBa_K1033906 range2408693 1 19 708 annotation2408700 1 BBa_B0015 range2408700 1 717 845 annotation2408691 1 BBa_B0034 range2408691 1 1 12 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_K1033906 1 tsPurple tsPurple, purple chromoprotein 2013-08-24T11:00:00Z 2015-05-08T01:08:49Z Synthetic chromoprotein from DNA 2.0. This chromoprotein naturally exhibits strong color when expressed. false false _1340_ 0 10137 9 In stock false Cloned from TinselPurple vector, DNA 2.0. false Sabri Jamal annotation2332100 1 tsPurple range2332100 1 1 690 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_K1357008_sequence 1 aaagaggagaaatactagatggcgagcttggttaagaaagatatgtgtgttaagatgacgatggaaggtactgtgaacggttatcactttaagtgcgttggcgagggtgaaggcaagccgttcgagggcacgcagaacatgcgcattcgtgtcaccgagggcggtccgctgccttttgcattcgacatcctggccccgtgctgtatgtacggctctaagaccttcattaaacacgtgagcggtatcccggattactttaaagagtcctttccagagggcttcacttgggaacgtacccagatttttgaggacggtggtgttctgaccgcgcaccaagacaccagcctggaaggtaattgcctgatctataaagtgaaggttctgggtaccaatttcccggcgaatggtccggtgatgcaaaagaaaaccgcgggttgggagccgtgcgtcgagatgctgtatccgcgtgacggcgtcttgtgtggtcagagcttgatggcgctgaagtgcaccgatggcaatcatctgaccagccacctgcgcacgacgtatcgtagccgtaaaccgagcaacgccgttaacatgccggagttccattttggtgaccatcgcatcgaaatcctgaaagctgagcagggcaaattctacgaacaatacgaatcggctgtcgcacgttacagcgatgtgccggaaaaagcgacgtaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1033906_sequence 1 atggcgagcttggttaagaaagatatgtgtgttaagatgacgatggaaggtactgtgaacggttatcactttaagtgcgttggcgagggtgaaggcaagccgttcgagggcacgcagaacatgcgcattcgtgtcaccgagggcggtccgctgccttttgcattcgacatcctggccccgtgctgtatgtacggctctaagaccttcattaaacacgtgagcggtatcccggattactttaaagagtcctttccagagggcttcacttgggaacgtacccagatttttgaggacggtggtgttctgaccgcgcaccaagacaccagcctggaaggtaattgcctgatctataaagtgaaggttctgggtaccaatttcccggcgaatggtccggtgatgcaaaagaaaaccgcgggttgggagccgtgcgtcgagatgctgtatccgcgtgacggcgtcttgtgtggtcagagcttgatggcgctgaagtgcaccgatggcaatcatctgaccagccacctgcgcacgacgtatcgtagccgtaaaccgagcaacgccgttaacatgccggagttccattttggtgaccatcgcatcgaaatcctgaaagctgagcagggcaaattctacgaacaatacgaatcggctgtcgcacgttacagcgatgtgccggaaaaagcgacgtaataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z