BBa_K136003 1 BBa_K136003 Promoter of flhB gene from E. coli flagella 2008-08-11T11:00:00Z 2015-05-08T01:10:02Z This part comes from the genome of ''E.coli'' K12 strain MG1655. ''flhB'' is a class 2 gene that is part of the construction of the flagella ( ''Ordering Genes in a Flagella Pathway by Analysis of Expression Kinetics from Living Bacteria'' - S. Kalir, J. McClure, K. Pabbaraju, C. Southward, M. Ronen, S. Leibler, M. G. Surette, U. Alon ). Its promoter is consitutively repressed. It is activated by FlhD₄C₂ and maybe by FliA with different strength ( ''Using a Quantitative Blueprint to Reprogram the Dynamics of the Flagella Gene Network'' - Shiraz Kalir and Uri Alon ). '''Work in progress :''' Deeper quantitative characterization true false _211_ 0 3012 9 Discontinued false The primers used to amplify this sequence are : *Forward : GTTTCTTCGAATTCGCGGCCGCTTCTAGAGCCACGTCATATCAGGCGGTCTGATAAGG *Reverse : GTTTCTTCCTGCAGCGGCCGCTACTAGTAGTTTTGTCGTCGCTCTCGTCAGACACGTC false Cyprien Maisonnier annotation1971576 1 Initiation for Transcription range1971576 1 153 153 annotation1971574 1 FlhDC Binding site 1 range1971574 1 79 94 annotation1971575 1 FlhDC Binding site 2 range1971575 1 106 121 BBa_K136003_sequence 1 ccacgtcatatcaggcggtctgataaggcgatgacgccgcatccgacaaacgcacactatgcttgatgtgtggcagcaaaagccctaaatcccgcctgttttgccccttactcaaaccattgaacgctttgcgctctggcatcattcacgcttaatactctttccaggattggcgacgtgtctgacgagagcgacgacaaaac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z