BBa_K136004 1 BBa_K136004 Promoter of flhDC gene from E. coli flagella 2008-08-11T11:00:00Z 2015-05-08T01:10:02Z This part comes from the genome of ''E.coli'' K12 strain MG1655. ''flhDC'' is the only class 1 gene that is part of the construction of the flagella. It is the master regulator of the biosynthesis of the flagella ( ''Ordering Genes in a Flagella Pathway by Analysis of Expression Kinetics from Living Bacteria'' - S. Kalir, J. McClure, K. Pabbaraju, C. Southward, M. Ronen, S. Leibler, M. G. Surette, U. Alon ). The promoter of ''flhDC'' is regulated by many transcription factors, for instance, OmpR* and EnvZ* are two repressors of this gene. '''Work in progress :''' Characterization of the repression by OmpR* and EnvZ* true false _211_ 0 3012 9 Discontinued false The PCR on colony to amplify the promoter of ''flhDC'' did not work. We amplified both the promoter and the gene and then we did a specific amplification of the promoter from the full operon. We had a PCR amplicon of the right length this time. The primers used to amplify the promoter and the gene are : * Forward : GTTTCTTCGAATTCGCGGCCGCTTCTAGAGTTGTATGTGCGTGTAGTGACGAGTACAG * Reverse : GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTAAACAGCCTGTACTCTCTGTTCATCC Then to amplify only the promoter we used : * Forward : GTTTCTTCGAATTCGCGGCCGCTTCTAGAGTTGTATGTGCGTGTAGTGACGAGTACAG * Reverse : GTTTCTTCCTGCAGCGGCCGCTACTAGTATCCCACCCAGAATAACCAACTTTAT false Cyprien Maisonnier annotation1971577 1 Transcription start base range1971577 1 36 36 annotation1971578 1 OmpR binding site range1971578 1 43 63 BBa_K136004_sequence 1 ttgtatgtgcgtgtagtgacgagtacagttgcgtcgatttaggaaaaatcttagataagtgtaaagacccatttctatttgtaaggacatattaaaccaaaaaggtggttctgcttattgcagcttatcgcaactattctaatgctaattattttttaccggggcttcccggcgacatcacggggtgcggtgaaaccgcataaaaataaagttggttattctgggtggga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z