BBa_K136006 1 BBa_K136006 flgA promoter followed by its natural RBS 2008-10-24T11:00:00Z 2015-05-08T01:10:02Z This part comes from the genome of E.coli K12 strain MG1655. Promoter of flgA gene from E. coli flagella flgA is a class 2 gene that is part of the construction of the flagella ( Ordering Genes in a Flagella Pathway by Analysis of Expression Kinetics from Living Bacteria - S. Kalir, J. McClure, K. Pabbaraju, C. Southward, M. Ronen, S. Leibler, M. G. Surette, U. Alon ). Its promoter is consitutively repressed. It is activated by FlhD4C2 and maybe by FliA with different strength ( Using a Quantitative Blueprint to Reprogram the Dynamics of the Flagella Gene Network - Shiraz Kalir and Uri Alon ). false false _211_ 0 3262 9 It's complicated false >forward primer GTTTCTTCGAATTCGCGGCCGCTTCTAGAGAGCATATCTCCTCCGCAGGTATCAAAAT >reverse primer GTTTCTTCCTGCAGCGGCCGCTACTAGTAACAGTATCGCGATGATCGCCACGCTACGT false Kok-Phen YAN annotation1999347 1 nautral flgA RBS range1999347 1 146 154 annotation1986987 1 flhDC binding site range1986987 1 89 104 annotation1986986 1 flhDC binding site range1986986 1 63 78 annotation1986989 1 transcription initiation range1986989 1 138 138 annotation1986988 1 ATG range1986988 1 160 162 BBa_K136006_sequence 1 agcatatctcctccgcaggtatcaaaattctgccatcagcttaaatgcctttacgcgcgcgttatcggcggaataaacgcaaaatgggtcgctatttatgccgttgatggtcattgcggacaggtacaattcacgttgtagaaatggctgggggcgaaaatgctgataataaaacgtagcgtggcgatcatcgcgatactgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z