BBa_K136007 1 BBa_K136007 flgB promotor (RBS WT) 2008-10-24T11:00:00Z 2015-05-08T01:10:02Z This part comes from the genome of E.coli K12 strain MG1655. Promoter of flgB gene from E. coli flagella flgB is a class 2 gene that is part of the construction of the flagella ( Ordering Genes in a Flagella Pathway by Analysis of Expression Kinetics from Living Bacteria - S. Kalir, J. McClure, K. Pabbaraju, C. Southward, M. Ronen, S. Leibler, M. G. Surette, U. Alon ). Its promoter is consitutively repressed. It is activated by FlhD4C2 and maybe by FliA with different strength ( Using a Quantitative Blueprint to Reprogram the Dynamics of the Flagella Gene Network - Shiraz Kalir and Uri Alon ). true false _211_ 0 3262 9 Discontinued false >forward primer GTTTCTTCGAATTCGCGGCCGCTTCTAGAGACAGTATCGCGATGATCGCCACGCTACG >reverse primer GTTTCTTCCTGCAGCGGCCGCTACTAGTAAGCATATCTCCTCCGCAGGTATCAAAATT false Kok-Phen YAN annotation1986992 1 atg range1986992 1 198 200 annotation1986990 1 flhDC binding site range1986990 1 98 113 annotation1986993 1 transcription initiation site range1986993 1 173 173 annotation1986991 1 flhDC binding site range1986991 1 124 139 BBa_K136007_sequence 1 acagtatcgcgatgatcgccacgctacgttttattatcagcattttcgcccccagccatttctacaacgtgaattgtacctgtccgcaatgaccatcaacggcataaatagcgacccattttgcgtttattccgccgataacgcgcgcgtaaaggcatttaagctgatggcagaattttgatacctgcggaggagatatgct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z