BBa_K136008 1 BBa_K136008 flhB promoter followed by its natural RBS 2008-10-24T11:00:00Z 2015-05-08T01:10:02Z This part comes from the genome of E.coli K12 strain MG1655. Promoter of flhB gene from E. coli flagella flhB is a class 2 gene that is part of the construction of the flagella ( Ordering Genes in a Flagella Pathway by Analysis of Expression Kinetics from Living Bacteria - S. Kalir, J. McClure, K. Pabbaraju, C. Southward, M. Ronen, S. Leibler, M. G. Surette, U. Alon ). Its promoter is consitutively repressed. It is activated by FlhD4C2 and maybe by FliA with different strength ( Using a Quantitative Blueprint to Reprogram the Dynamics of the Flagella Gene Network - Shiraz Kalir and Uri Alon ). false false _211_ 0 3262 9 It's complicated false >forward primer GTTTCTTCGAATTCGCGGCCGCTTCTAGAGCCACGTCATATCAGGCGGTCTGATAAGG >reverse primer GTTTCTTCCTGCAGCGGCCGCTACTAGTAGTTTTGTCGTCGCTCTCGTCAGACACGTC false Kok-Phen YAN annotation1986994 1 flhDC binding site range1986994 1 79 94 annotation1999346 1 natural flhB RBS range1999346 1 166 173 annotation1986996 1 transcription initiation site range1986996 1 153 153 annotation1986995 1 flhDC binding site range1986995 1 106 121 annotation1999345 1 GTG range1999345 1 178 180 BBa_K136008_sequence 1 ccacgtcatatcaggcggtctgataaggcgatgacgccgcatccgacaaacgcacactatgcttgatgtgtggcagcaaaagccctaaatcccgcctgttttgccccttactcaaaccattgaacgctttgcgctctggcatcattcacgcttaatactctttccaggattggcgacgtgtctgacgagagcgacgacaaaac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z