BBa_K136009 1 BBa_K136009 fliL promoter followed by its natural RBS 2008-10-24T11:00:00Z 2015-05-08T01:10:02Z This part comes from the genome of E.coli K12 strain MG1655. Promoter of fliL gene from E. coli flagella fliL is a class 2 gene that is part of the construction of the flagella ( Ordering Genes in a Flagella Pathway by Analysis of Expression Kinetics from Living Bacteria - S. Kalir, J. McClure, K. Pabbaraju, C. Southward, M. Ronen, S. Leibler, M. G. Surette, U. Alon, ). Its promoter is consitutively repressed. It is activated by flhD4C2 and by fliA with different forces ( Using a Quantitative Blueprint to Reprogram the Dynamics of the Flagella Gene Network - Shiraz Kalir and Uri Alon ). false false _211_ 0 3262 9 It's complicated false >forward primer TCGAATTCGCGGCCGCTTCTAGAGCAAGGGCGTGTAACAGGCAAC >reverse primer TCCTGCAGCGGCCGCTACTAGTAGTCATGTGTTGCGGTCTTCCTGTG false Kok-Phen YAN annotation1987004 1 FlhDC binding site range1987004 1 70 85 annotation1999343 1 ATG range1999343 1 150 152 annotation1999344 1 natural fliL RBS range1999344 1 134 141 annotation1987003 1 transcription initiation site range1987003 1 116 116 annotation1987002 1 FlhDC binding site range1987002 1 44 59 annotation1987001 1 transcription initiation site range1987001 1 127 127 BBa_K136009_sequence 1 caagggcgtgtaacaggcaacagcggcgttgatattttcgcctaacgtcagaggtagcaccgtaatccgcgtcttttccccgctttgttgcgctcaagacgcaggataattagccgataagcagtagcgacacaggaagaccgcaacacatgac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z