BBa_K136010 1 BBa_K136010 fliA promoter 2008-10-24T11:00:00Z 2015-05-08T01:10:02Z This part comes from the genome of E. coli K12 strain MG1655. FliA is a transcription factor involved in the formation of the flagella in E. coli. The promotor of fliA is induced by FlhDC. FliA seems to have a positive autoregulation on its promotor. false false _211_ 0 3262 9 It's complicated false primers used false Kok-Phen YAN annotation1999348 1 natural fliA RBS range1999348 1 330 337 annotation1987040 1 FlhDC binding site 1 range1987040 1 198 225 annotation1987042 1 A mutated to G range1987042 1 263 263 annotation1987046 1 transcription initiation site range1987046 1 293 293 annotation1987043 1 A mutated to G range1987043 1 316 316 annotation1987041 1 FlhDC binding site 2 range1987041 1 226 261 annotation1987044 1 ATG range1987044 1 342 344 annotation1987045 1 transcription initiation site range1987045 1 282 282 BBa_K136010_sequence 1 cctgattaactgagactgacggcaacgccaaattgcctgatgcgctgcgcttatcaggcctacaagttgaattgcaatttattgaatttgcacatttttgtaggccggataaggcgtttacgccgcatccggcaacataaagcgcaatttgtcagcaacgtgcttccccgccaccggcggggtttttttctgcctggaatttacctgtaacccccaaataacccctcatttcacccactaatcgtccgattaaaaaccctgcggaaacggataatcatgccgataactcatataacgcagggctgtttatcgtgagttcactctataccgctgaaggtgtaatgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z