BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_J04051 1 BBa_J04051 RFP with tag 2005-06-07T11:00:00Z 2015-08-31T04:08:13Z Davidson Synth-Aces BBa_E1010 with an LVA tag added via PCR. false false _16_ 0 328 16 It's complicated false false tammy674 annotation1507347 1 mrfp1 range1507347 1 1 675 annotation1507863 1 Stop range1507863 1 715 720 annotation1508160 1 Start range1508160 1 1 3 annotation1507968 1 LVA range1507968 1 676 714 BBa_K136055 1 BBa_K136055 flhB promoter + WT RBS (K136008) - mRFP tripart + LVA (I732078) 2008-10-24T11:00:00Z 2015-05-08T01:10:03Z Parts assembling flhB promotor + WT RBS (K136008) - mRFP tripart + LVA (I732078) false false _211_ 0 3262 9 It's complicated false Parts assembling false Kok-Phen YAN component1987858 1 BBa_B0010 component1987852 1 BBa_B0034 component1987860 1 BBa_B0012 component1987850 1 BBa_K136008 component1987857 1 BBa_J04051 annotation1987860 1 BBa_B0012 range1987860 1 1046 1086 annotation1987850 1 BBa_K136008 range1987850 1 1 203 annotation1987857 1 BBa_J04051 range1987857 1 230 949 annotation1987858 1 BBa_B0010 range1987858 1 958 1037 annotation1987852 1 BBa_B0034 range1987852 1 212 223 BBa_K136008 1 BBa_K136008 flhB promoter followed by its natural RBS 2008-10-24T11:00:00Z 2015-05-08T01:10:02Z This part comes from the genome of E.coli K12 strain MG1655. Promoter of flhB gene from E. coli flagella flhB is a class 2 gene that is part of the construction of the flagella ( Ordering Genes in a Flagella Pathway by Analysis of Expression Kinetics from Living Bacteria - S. Kalir, J. McClure, K. Pabbaraju, C. Southward, M. Ronen, S. Leibler, M. G. Surette, U. Alon ). Its promoter is consitutively repressed. It is activated by FlhD4C2 and maybe by FliA with different strength ( Using a Quantitative Blueprint to Reprogram the Dynamics of the Flagella Gene Network - Shiraz Kalir and Uri Alon ). false false _211_ 0 3262 9 It's complicated false >forward primer GTTTCTTCGAATTCGCGGCCGCTTCTAGAGCCACGTCATATCAGGCGGTCTGATAAGG >reverse primer GTTTCTTCCTGCAGCGGCCGCTACTAGTAGTTTTGTCGTCGCTCTCGTCAGACACGTC false Kok-Phen YAN annotation1986996 1 transcription initiation site range1986996 1 153 153 annotation1986994 1 flhDC binding site range1986994 1 79 94 annotation1986995 1 flhDC binding site range1986995 1 106 121 annotation1999345 1 GTG range1999345 1 178 180 annotation1999346 1 natural flhB RBS range1999346 1 166 173 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_J04051_sequence 1 atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgctaggcctgctgcaaacgacgaaaactacgctttagtagcttaataa BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K136008_sequence 1 ccacgtcatatcaggcggtctgataaggcgatgacgccgcatccgacaaacgcacactatgcttgatgtgtggcagcaaaagccctaaatcccgcctgttttgccccttactcaaaccattgaacgctttgcgctctggcatcattcacgcttaatactctttccaggattggcgacgtgtctgacgagagcgacgacaaaac BBa_K136055_sequence 1 ccacgtcatatcaggcggtctgataaggcgatgacgccgcatccgacaaacgcacactatgcttgatgtgtggcagcaaaagccctaaatcccgcctgttttgccccttactcaaaccattgaacgctttgcgctctggcatcattcacgcttaatactctttccaggattggcgacgtgtctgacgagagcgacgacaaaactactagagaaagaggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgctaggcctgctgcaaacgacgaaaactacgctttagtagcttaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0034_sequence 1 aaagaggagaaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z