BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_K1361995 1 BBa_K1361995 CsgBtrunc, curli fiber nucleator with a C-terminnal deletion 2014-10-03T11:00:00Z 2015-05-08T01:10:04Z This part is collected by PCR from genome of E coli. DH5alpha. This part is Curli fiber nucleator subunit protein CsgB with deletion of C-terminal amino acid from 133 to 155 that is lost the ability to attach outer membrane of the cell. false false _1737_ 0 18617 9 Not in stock false Deletion is designed referring Hammer, Neal D., Jens C. Schmidt, and Matthew R. Chapman. "The curli nucleator protein, CsgB, contains an amyloidogenic domain that directs CsgA polymerization." Proceedings of the National Academy of Sciences 104.30 (2007): 12494-12499. false Shoujie Sun annotation2393388 1 cds range2393388 1 1 399 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 annotation1690 1 polya range1690 1 28 41 BBa_K1361006 1 BBa_K1361006 Curli Fiber generator where CsgBtrunc, a dissociative nucleator, under the control of Pbad promoter 2014-10-06T11:00:00Z 2015-05-08T01:10:04Z CsgAC and CsgBtrunc were collected by PCR from genome of E coli DH5alpha respectively. This part contains the major subunit of curli fiber CsgA and its nucleator CsgBtrunc, in which CsgA is constitutive expression whereas CsgBtrunc is under the control of Pbad promotor. CsgBtrunc is different from native CsgB from the deletion of C-terminal amino acid from 133 to 155 that it cannot attach cell outer membrane. And CsgBtrunc itself is highly aggregative in the culture. This part is designed to be used for immediate generate of large amount of curli fiber after adding of the inducer and a stronger promoter for CsgA was chosen to parallel with BBa_K1361002. This part cannot functioning alone without expression of CsgEFG genes in the same cell, for they coding the outer membrane channel secrete system for CsgA and CsgB. false false _1737_ 0 16915 9 It's complicated false The PstI loci within CsgA sequence has been replaced from CTGCAG to CTGCCG. false Shoujie Sun component2398558 1 BBa_K206000 component2398573 1 BBa_K880005 component2398580 1 BBa_K1361998 component2398562 1 BBa_K1361995 component2398569 1 BBa_B0015 component2398560 1 BBa_B0034 annotation2398569 1 BBa_B0015 range2398569 1 564 692 annotation2398573 1 BBa_K880005 range2398573 1 701 755 annotation2398580 1 BBa_K1361998 range2398580 1 762 1608 annotation2398562 1 BBa_K1361995 range2398562 1 157 555 annotation2398560 1 BBa_B0034 range2398560 1 139 150 annotation2398558 1 BBa_K206000 range2398558 1 1 130 BBa_K1361998 1 BBa_K1361998 Curli Fiber assembly associated protein CsgA, CsgC 2014-10-02T11:00:00Z 2015-05-08T01:10:04Z PCR on genomic DNA from E coli. DH5alpha strain. And site-directed mutation by overlap PCR primers. CsgA, CsgC genes are directly PCRed from E coli. DH5alpha genome as a whole. There is a scar sequence between CsgA and CsgC coding region that contains a promoter sequence may constitutively transcript CsgC gene. CsgA protein is the major subunit of Curli Fiber. CsgC may regulate CsgG outer membrane assembly of channel protein CsgG and pore activity through modification of C230 in CsgG. false false _1737_ 0 16915 9 Not in stock false The PstI loci within CsgA sequence has been replaced from CTGCAG to CTGCCG. false Shoujie Sun annotation2392517 1 stop range2392517 1 845 847 annotation2392514 1 stop range2392514 1 454 456 annotation2392515 1 CsgC range2392515 1 515 847 annotation2392516 1 start range2392516 1 515 517 annotation2392512 1 CsgA range2392512 1 1 456 annotation2392513 1 start range2392513 1 1 3 BBa_K206000 1 pBAD pBAD strong 2009-10-13T11:00:00Z 2015-05-08T01:11:23Z The sequence was obtained by applying all mutations that upregulated AraC binding and subsequent promoter activity listed in reference [1]. Released HQ 2013 pBAD is an <i>E.coli</i> promoter that is induced by L-arabinose. K206000 is a mutagenized pBAD promoter that is responsive to lower concentrations of arabinose than wild type (<partinfo>I13453</partinfo>) and, additionally, exhibits a higher maximum of protein expression as measured by coupling to a fluorescent reporter. false false _307_ 0 4172 9 In stock true There were no special design considerations. false Amelia Hardjasa annotation2049254 1 AraI2 range2049254 1 61 78 annotation2049252 1 promoter range2049252 1 1 131 annotation2049253 1 AraI1 range2049253 1 40 57 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K880005 1 BBa_K880005 Strong promoter, strong RBS combination for high expression levels of proteins 2012-09-28T11:00:00Z 2015-05-08T01:13:40Z It is a combination of strong promoter (J23100) and RBS (B0034). Released HQ 2013 -J23100+B0034 -Strong promoter, strong RBS combination for high expression levels of proteins Consensus constitutive promoter and RBS sequence-produces strongest possible expression. false false _1142_ 0 9403 9 In stock false Enter design considerations. false Josh Atkinson, Mike Ferguson, and Ben Parker component2204228 1 BBa_J23100 component2204230 1 BBa_B0034 annotation2204230 1 BBa_B0034 range2204230 1 44 55 annotation2204228 1 BBa_J23100 range2204228 1 1 35 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1361998_sequence 1 atgaaacttttaaaagtagcagcaattgcagcaatcgtattctccggtagcgctctggcaggtgttgttcctcagtacggcggcggcggtaaccacggtggtggcggtaataatagcggcccaaattctgagctgaacatttaccagtacggtggcggtaactctgcacttgctctgcaaactgatgcccgtaactctgacttgactattacccagcatggcggcggtaatggtgcagatgttggtcagggctcagatgacagctcaatcgatctgacccaacgtggcttcggtaacagcgctactcttgatcagtggaacggcaaaaattctgaaatgacggttaaacagttcggtggtggcaacggtgccgcagttgaccagactgcatctaactcctccgtcaacgtgactcaggttggctttggtaacaacgcgaccgctcatcagtactaatacatcatttgtattacagaaacagggcgcaagccctgttttttttcgggagaagaatatgaatacgttattactccttgcggcactttccagtcagataacctttaatacgacccagcaaggggatgtgtataccattattcctgaagtcactcttactcaatcttgtctgtgcagagtacaaatattgtccctgcgcgaaggcagttcagggcaaagtcagacgaagcaagaaaagaccctttcattgcctgctaatcaacccattgctttgacgaagttgagtttaaatatttccccggacgatcgggtgaaaatagttgttactgtttctgatggacagtcacttcatttatcacaacaatggccgccctcttcagaaaagtcttaa BBa_B0034_sequence 1 aaagaggagaaa BBa_K1361995_sequence 1 atgaaaaacaaattgttatttatgatgttaacaatactgggtgcgcctgggattgcagccgcagcaggttatgatttagctaattcagaatataacttcgcggtaaatgaattgagtaagtcttcatttaatcaggcagccataattggtcaagctgggactaataatagtgctcagttacggcagggaggctcaaaacttttggcggttgttgcgcaagaaggtagtagcaaccgggcaaagattgaccagacaggagattataaccttgcatatattgatcaggcgggcagtgccaacgatgccagtatttcgcaaggtgcttatggtaatactgcgatgattatccagaaaggttctggtaataaagcaaatattacacagtatggtactcaataa BBa_K206000_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcaagatagtccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagc BBa_K880005_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagaaagaggagaaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1361006_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcaagatagtccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagctactagagaaagaggagaaatactagatgaaaaacaaattgttatttatgatgttaacaatactgggtgcgcctgggattgcagccgcagcaggttatgatttagctaattcagaatataacttcgcggtaaatgaattgagtaagtcttcatttaatcaggcagccataattggtcaagctgggactaataatagtgctcagttacggcagggaggctcaaaacttttggcggttgttgcgcaagaaggtagtagcaaccgggcaaagattgaccagacaggagattataaccttgcatatattgatcaggcgggcagtgccaacgatgccagtatttcgcaaggtgcttatggtaatactgcgatgattatccagaaaggttctggtaataaagcaaatattacacagtatggtactcaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagttgacggctagctcagtcctaggtacagtgctagctactagagaaagaggagaaatactagatgaaacttttaaaagtagcagcaattgcagcaatcgtattctccggtagcgctctggcaggtgttgttcctcagtacggcggcggcggtaaccacggtggtggcggtaataatagcggcccaaattctgagctgaacatttaccagtacggtggcggtaactctgcacttgctctgcaaactgatgcccgtaactctgacttgactattacccagcatggcggcggtaatggtgcagatgttggtcagggctcagatgacagctcaatcgatctgacccaacgtggcttcggtaacagcgctactcttgatcagtggaacggcaaaaattctgaaatgacggttaaacagttcggtggtggcaacggtgccgcagttgaccagactgcatctaactcctccgtcaacgtgactcaggttggctttggtaacaacgcgaccgctcatcagtactaatacatcatttgtattacagaaacagggcgcaagccctgttttttttcgggagaagaatatgaatacgttattactccttgcggcactttccagtcagataacctttaatacgacccagcaaggggatgtgtataccattattcctgaagtcactcttactcaatcttgtctgtgcagagtacaaatattgtccctgcgcgaaggcagttcagggcaaagtcagacgaagcaagaaaagaccctttcattgcctgctaatcaacccattgctttgacgaagttgagtttaaatatttccccggacgatcgggtgaaaatagttgttactgtttctgatggacagtcacttcatttatcacaacaatggccgccctcttcagaaaagtcttaa BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z