BBa_K1361993 1 BBa_K1361993 CsgC, curli fiber secrete accessory molecules 2014-10-05T11:00:00Z 2015-05-08T01:10:04Z CsgC were collected by PCR from genomic DNA of E coli. DH5alpha strain. Within the periplasm, CsgC may regulate CsgG outer membrane assembly and pore activity through modification of C230 in CsgG. And its essential for curli fiber assembly. false false _1737_ 0 16915 9 Not in stock false None false Shoujie Sun annotation2397401 1 stop range2397401 1 331 333 annotation2397399 1 cds range2397399 1 1 333 annotation2397400 1 start range2397400 1 1 3 BBa_K1361993_sequence 1 atgaatacgttattactccttgcggcactttccagtcagataacctttaatacgacccagcaaggggatgtgtataccattattcctgaagtcactcttactcaatcttgtctgtgcagagtacaaatattgtccctgcgcgaaggcagttcagggcaaagtcagacgaagcaagaaaagaccctttcattgcctgctaatcaacccattgctttgacgaagttgagtttaaatatttccccggacgatcgggtgaaaatagttgttactgtttctgatggacagtcacttcatttatcacaacaatggccgccctcttcagaaaagtcttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z