BBa_K1361997 1 BBa_K1361997 CsgB, curlin nucleator protein, minor subunit in curli complex 2014-10-02T11:00:00Z 2015-05-08T01:10:04Z PCR on genomic DNA from E coli. DH5alpha strain. CsgB is a secretive protein that attached cells' outer membranes. It plays key role in curli fiber polymerization. CsgB is the nucleator for CsgA aggregation in vivo, that facilitate the transformation of soluble CsgA into polymer fiber. false false _1737_ 0 16915 9 Not in stock false CsgB can be designed under inductively control while make CsgACEFG genes constitutively express respectly. Using this method could achieve the immediate synthesis of curli fiber after inducer has been added. false Shoujie Sun annotation2392541 1 CsgB range2392541 1 1 456 annotation2392540 1 stop range2392540 1 454 456 annotation2392539 1 start range2392539 1 1 3 BBa_K1361997_sequence 1 atgaaaaacaaattgttatttatgatgttaacaatactgggtgcgcctgggattgcagccgcagcaggttatgatttagctaattcagaatataacttcgcggtaaatgaattgagtaagtcttcatttaatcaggcagccataattggtcaagctgggactaataatagtgctcagttacggcagggaggctcaaaacttttggcggttgttgcgcaagaaggtagtagcaaccgggcaaagattgaccagacaggagattataaccttgcatatattgatcaggcgggcagtgccaacgatgccagtatttcgcaaggtgcttatggtaatactgcgatgattatccagaaaggttctggtaataaagcaaatattacacagtatggtactcaaaaaacggcaattgtagtgcagagacagtcgcaaatggctattcgcgtgacacaacgttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z