BBa_K1361999 1 BBa_K1361999 Curli Fiber major monomer-CsgA 2014-10-02T11:00:00Z 2015-05-08T01:10:04Z PCR on genomic DNA from E coli. DH5alpha strain. And site-directed mutation by overlap PCR primers. CsgA is the major monomer of curli fiber, molecular weight of which is 15.049 kD (from nucleotide sequence) . It has been code modified for biobricks standard. In vivo, its alone has little polymerizability and CsgB protein is requested for quick polymerization of CsgA. false false _1737_ 0 16915 9 Not in stock false The PstI loci within CsgA sequence has been replaced from CTGCAG to CTGCCG. false Shoujie Sun annotation2392667 1 start range2392667 1 1 3 annotation2392668 1 stop range2392668 1 454 456 annotation2392486 1 CsgA range2392486 1 1 456 BBa_K1361999_sequence 1 atgaaacttttaaaagtagcagcaattgcagcaatcgtattctccggtagcgctctggcaggtgttgttcctcagtacggcggcggcggtaaccacggtggtggcggtaataatagcggcccaaattctgagctgaacatttaccagtacggtggcggtaactctgcacttgctctgcaaactgatgcccgtaactctgacttgactattacccagcatggcggcggtaatggtgcagatgttggtcagggctcagatgacagctcaatcgatctgacccaacgtggcttcggtaacagcgctactcttgatcagtggaacggcaaaaattctgaaatgacggttaaacagttcggtggtggcaacggtgctgccgttgaccagactgcatctaactcctccgtcaacgtgactcaggttggctttggtaacaacgcgaccgctcatcagtactaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z