BBa_K1362090 1 T7 RBS strong T7 RBS 2014-10-02T11:00:00Z 2015-05-08T01:10:04Z synthesized as found in the T7 genome and several commercial expression plasmids. RFC10 compatible strong RBS derived from the T7 phage gene 10a (major capsid protein)[1]. When assembled to a coding part with the A of the start codon being part of the XbaI site, the RBS will be shifted one bp downstream compared to the native sequence. The sequence was successfully used by the iGEM team Heidelberg 2014 for the expression of many proteins in E.coli. 1. Olinss, P. & Rangwala, S. H. Derived from Bacteriophage T7 mRNA Acts ELS an Enhancer of Translation of the lac2 Gene in. 16973???16976 (1989). false false _1738_ 0 22830 9 It's complicated false The 18 bp including the XbaI that can be found upstream of the presumably important part of the RBS were included into the sequence just to make sure it works. However to fully comply with RFC10 a G was inserted behind the XbaI site. false Constantin Ahlmann-Eltze, Charlotte Bunne, Magdalena B??scher, Jan Gleixner, Max Horn, Anna Huhn, Nils Klughammer, Jakob Kreft, Elisabeth Sch??fer, Carolin Schmelas, Silvan Schmitz, Max Waldha annotation2393796 1 Shine-Dalgarno range2393796 1 21 28 annotation2393795 1 t7 RBS range2393795 1 11 28 BBa_K1362999 1 BBa_K1362999 iGEMHD tag 2014-10-07T11:00:00Z 2015-05-08T01:10:06Z Directly synthesized as an oligo as backtranslated with EMBOSS[1]. ==References== 1. Rice, P., Longden, I. & Bleasby, A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 16, 276???7 (2000). This Part adds ultimate coolness to you your part. More seriously, it served us as a random sequence being a better overlap site for CPEC cloning than the RFC[10] suffix. false false _1738_ 0 22830 9 Not in stock false We aimed for a sequence without secondary structures, balanced GC content. false Constantin Ahlmann-Eltze, Charlotte Bunne, Magdalena Büscher, Jan Gleixner, Max Horn, Anna Huhn, Nils Klughammer, Jakob Kreft, Elisabeth Schäfer, Carolin Schmelas, Silvan Schmitz, Max Waldha annotation2400472 1 stop range2400472 1 24 26 annotation2400473 1 stop range2400473 1 21 23 annotation2400474 1 iGEMHD range2400474 1 3 20 BBa_K1362414 1 RFC105 A N-terminal start overhang (T)(A)-(G)ATG=RBS+Start RFC[105] A 2014-10-06T11:00:00Z 2015-05-08T01:10:05Z This standard overhang part was developed as part of the iGEM team Heidelberg 2014's Intein Toolbox [[#References[1]]]. All standard sequences can be reviewed in RFC[???] [[#References[2]]]. This is a standard overhang sequence for in-frame cloning of Proteins of Interest in front or behind an Intein. A detailed cloning strategy is found on the iGEM team Heidelberg 2014's [[http://2014.igem.org/Team:Heidelberg|wiki page]] as well as in RFC[???]. Specifically, this part contains the overhang A used to insert a protein behind any RFC[10] compatible RBS and in-frame with the start-codon. It lies within the four bases formed by the second last base of the XbaI/SpeI scar or the first base in front of start codon respectively and the start codon itself. false false _1738_ 0 12377 9 Not in stock false This part is only the sequence of a standard overhang. It will not be sent in as physical DNA and was merely created to easily compose new parts in the RFC[???] standard. In the actual cloning process this sequence was and is recommended to be inserted with the according PCR primers. false Constantin Ahlmann-Eltze, Charlotte Bunne, Magdalena B??scher, Jan Gleixner, Max Horn, Anna Huhn, Nils Klughammer, Jakob Kreft, Elisabeth Sch??fer, Carolin Schmelas, Silvan Schmitz, Max Waldha BBa_K1362011 1 BBa_K1362011 RBS + λ-Lysozyme 2014-10-07T11:00:00Z 2015-05-08T01:10:04Z ??? ??? false false _1738_ 0 22920 9 In stock false ??? false Constantin Ahlmann-Eltze, Charlotte Bunne, Magdalena Büscher, Jan Gleixner, Max Horn, Anna Huhn, Nils Klughammer, Jakob Kreft, Elisabeth Schäfer, Carolin Schmelas, Silvan Schmitz, Max Waldha component2430356 1 BBa_K1362421 component2430354 1 BBa_K1362432 component2430360 1 BBa_K1362999 component2430352 1 BBa_K1362414 component2430351 1 BBa_G0000 component2430350 1 BBa_K1362090 annotation2430350 1 BBa_K1362090 range2430350 1 1 29 annotation2430360 1 BBa_K1362999 range2430360 1 514 539 annotation2430354 1 BBa_K1362432 range2430354 1 39 509 annotation2430356 1 BBa_K1362421 range2430356 1 510 513 annotation2430352 1 BBa_K1362414 range2430352 1 36 38 annotation2430351 1 BBa_G0000 range2430351 1 30 35 BBa_K1362421 1 RFC105 Z C-terminal stop overhang TAAT=STOP+1/3Stop RFC[105] overhang Z 2014-10-06T11:00:00Z 2015-05-08T01:10:05Z This standard overhang part was developed as part of the iGEM team Heidelberg 2014's Intein Toolbox [[#References|[1]]]. All standard sequences can be reviewed in RFC[???] [[#References|[2]]]. This is a standard overhang sequence for in-frame cloning of Proteins of Interest in front or behind an Intein. A detailed cloning strategy is found on the iGEM team Heidelberg 2014's [http://2014.igem.org/Team:Heidelberg/parts wiki page] as well as in RFC[???]. Specifically, this part contains the overhang F used to insert the last part of an intein-fused protein directly in front of an RFC[10] double stop-codon. It lies within the first for bases of the stopstop sequence. false false _1738_ 0 12377 9 Not in stock false This part is only the sequence of a standard overhang. It will not be sent in as physical DNA and was merely created to easily compose new parts in the RFC[???] standard. In the actual cloning process this sequence was and is recommended to be inserted with the according PCR primers. false Constantin Ahlmann-Eltze, Charlotte Bunne, Magdalena B??scher, Jan Gleixner, Max Horn, Anna Huhn, Nils Klughammer, Jakob Kreft, Elisabeth Sch??fer, Carolin Schmelas, Silvan Schmitz, Max Waldha annotation2402257 1 stop range2402257 1 1 4 BBa_G0000 1 scar SpeI/XbaI scar for RBS-CDS junctions 2007-07-22T11:00:00Z 2015-08-31T04:07:27Z SpeI/XbaI scar This is the sequence of the SpeI/XbaI scar for RBS-CDS junctions in BioBricks standard assembly. false true _41_ 0 126 162 Not in stock false This is a shorter scar to ensure proper spacing between the RBS and CDS. false Reshma Shetty BBa_K1362432 1 LaLy λ-Lysozyme (cds only) 2014-10-07T11:00:00Z 2015-05-08T01:10:05Z ??? ??? false false _1738_ 0 22920 9 Not in stock false ??? false Constantin Ahlmann-Eltze, Charlotte Bunne, Magdalena Büscher, Jan Gleixner, Max Horn, Anna Huhn, Nils Klughammer, Jakob Kreft, Elisabeth Schäfer, Carolin Schmelas, Silvan Schmitz, Max Waldha annotation2407303 1 LaLy range2407303 1 1 471 BBa_K1362432_sequence 1 gtagaaatcaataatcaacgtaaggcgttcctcgatatgctggcgtggtcggagggaactgataacggacgtcagaaaaccagaaatcatggttatgacgtcattgtaggcggagagctatttactgattactccgatcaccctcgcaaacttgtcacgctaaacccaaaactcaaatcaacaggcgccggacgctaccagcttctttcccgttggtgggatgcctaccgcaagcagcttggcctgaaagacttctctccgaaaagtcaggacgctgtggcattgcagcagattaaggagcgtggcgctttacctatgattgatcgtggtgatatccgtcaggcaatcgaccgttgcagcaatatctgggcttcactgccgggcgctggttatggtcagttcgagcataaggctgacagcctgattgcaaaattcaaagaagcgggcggaacggtcagagagattgatgta BBa_G0000_sequence 1 tactag BBa_K1362414_sequence 1 atg BBa_K1362011_sequence 1 aataattttgtttaactttaagaaggagatactagatggtagaaatcaataatcaacgtaaggcgttcctcgatatgctggcgtggtcggagggaactgataacggacgtcagaaaaccagaaatcatggttatgacgtcattgtaggcggagagctatttactgattactccgatcaccctcgcaaacttgtcacgctaaacccaaaactcaaatcaacaggcgccggacgctaccagcttctttcccgttggtgggatgcctaccgcaagcagcttggcctgaaagacttctctccgaaaagtcaggacgctgtggcattgcagcagattaaggagcgtggcgctttacctatgattgatcgtggtgatatccgtcaggcaatcgaccgttgcagcaatatctgggcttcactgccgggcgctggttatggtcagttcgagcataaggctgacagcctgattgcaaaattcaaagaagcgggcggaacggtcagagagattgatgtataataaatcggtgaaatgcacgactgatag BBa_K1362999_sequence 1 aaatcggtgaaatgcacgactgatag BBa_K1362421_sequence 1 taat BBa_K1362090_sequence 1 aataattttgtttaactttaagaaggaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z