BBa_M0050 1 LAA AANDENYALAA. (Very fast) SsrA degradation tag. 2007-12-05T12:00:00Z 2015-05-08T01:13:51Z C-terminal degradation tags are commonly found in high turnover proteins in Escherichia coli. This sequence codes for the amino acid sequence AANDENYALAA, which when fused to the C-terminal of proteins, will make the protein susceptible to very fast degradation through SspB-mediated binding to the ClpX protease. The following rates of degradation of this tag are pulled from the corresponding references below: ~5 Vmax/ [Clpx6] min-1 from (1) ~0.5%/min on log scale from (2) ~1 min half life from (3) See the following references for further information on degradation rates and mechanisms of this tag: (1)McGinness, Baker, Sauer. 2006. Mol. Cell. 22:701. (2)Flynn et al 2003. Mol. Cell. 11: 671. Flynn et al. 2001. PNAS 98(19): 10584. Anderson et al 1998. App. Env. Microbiol. 64(6):2240. false false _11_ 0 2398 11 Not in stock false C-terminal tag. Degradation rate is very fast. Deviations from this sequence in key amino acids will lower degradation rates (see Parts BBa_M0051, BBa_M0052, BBa_M0053). Three C-terminal aa's (LAA in this case) are necessary and sufficient for ClpX binding and degradation. Upstream aa sequence serves as a binding site for SspB, which guides rapid binding to ClpX. false Felix Moser annotation1958880 1 WT SsrA tag AANDENYALAA range1958880 1 1 33 BBa_K1362438 1 Gly3 GGG linker 2014-10-07T11:00:00Z 2015-05-08T01:10:05Z Triglycine linker false false _1738_ 0 22920 9 Not in stock false false Constantin Ahlmann-Eltze, Charlotte Bunne, Magdalena B&uuml;scher, Jan Gleixner, Max Horn, Anna Huhn, Nils Klughammer, Jakob Kreft, Elisabeth Sch&auml;fer, Carolin Schmelas, Silvan Schmitz, Max Waldha BBa_K1362054 1 BBa_K1362054 SsrA degradation tag as RFC[105] C-terminal insert 2014-10-07T11:00:00Z 2015-05-08T01:10:04Z false false _1738_ 0 22920 9 In stock false false Constantin Ahlmann-Eltze, Charlotte Bunne, Magdalena B??scher, Jan Gleixner, Max Horn, Anna Huhn, Nils Klughammer, Jakob Kreft, Elisabeth Sch??fer, Carolin Schmelas, Silvan Schmitz, Max Waldha component2409703 1 BBa_K1362426 component2409701 1 BBa_K1362421 component2409694 1 BBa_K1362419 component2409699 1 BBa_M0050 component2409693 1 BBa_K1362425 component2409697 1 BBa_K1362438 component2409702 1 BBa_K1362423 component2409696 1 BBa_K1362433 annotation2409701 1 BBa_K1362421 range2409701 1 62 65 annotation2409702 1 BBa_K1362423 range2409702 1 66 72 annotation2409693 1 BBa_K1362425 range2409693 1 1 6 annotation2409696 1 BBa_K1362433 range2409696 1 11 19 annotation2409699 1 BBa_M0050 range2409699 1 29 61 annotation2409697 1 BBa_K1362438 range2409697 1 20 28 annotation2409703 1 BBa_K1362426 range2409703 1 73 76 annotation2409694 1 BBa_K1362419 range2409694 1 7 10 BBa_K1362433 1 CWE CWE (extein) 2014-10-07T11:00:00Z 2015-05-08T01:10:05Z ??? ??? false false _1738_ 0 22920 9 Not in stock false ??? false Constantin Ahlmann-Eltze, Charlotte Bunne, Magdalena B&uuml;scher, Jan Gleixner, Max Horn, Anna Huhn, Nils Klughammer, Jakob Kreft, Elisabeth Sch&auml;fer, Carolin Schmelas, Silvan Schmitz, Max Waldha annotation2407307 1 CWE range2407307 1 1 9 BBa_K1362421 1 RFC105 Z C-terminal stop overhang TAAT=STOP+1/3Stop RFC[105] overhang Z 2014-10-06T11:00:00Z 2015-05-08T01:10:05Z This standard overhang part was developed as part of the iGEM team Heidelberg 2014's Intein Toolbox [[#References|[1]]]. All standard sequences can be reviewed in RFC[???] [[#References|[2]]]. This is a standard overhang sequence for in-frame cloning of Proteins of Interest in front or behind an Intein. A detailed cloning strategy is found on the iGEM team Heidelberg 2014's [http://2014.igem.org/Team:Heidelberg/parts wiki page] as well as in RFC[???]. Specifically, this part contains the overhang F used to insert the last part of an intein-fused protein directly in front of an RFC[10] double stop-codon. It lies within the first for bases of the stopstop sequence. false false _1738_ 0 12377 9 Not in stock false This part is only the sequence of a standard overhang. It will not be sent in as physical DNA and was merely created to easily compose new parts in the RFC[???] standard. In the actual cloning process this sequence was and is recommended to be inserted with the according PCR primers. false Constantin Ahlmann-Eltze, Charlotte Bunne, Magdalena B??scher, Jan Gleixner, Max Horn, Anna Huhn, Nils Klughammer, Jakob Kreft, Elisabeth Sch??fer, Carolin Schmelas, Silvan Schmitz, Max Waldha annotation2402257 1 stop range2402257 1 1 4 BBa_K1362426 1 spacer Random sequence 2014-10-07T11:00:00Z 2015-05-08T01:10:05Z It was suddenly there. This sequence is of no use. false false _1738_ 0 22830 9 Not in stock false No consideration was performed by the designer. false Constantin Ahlmann-Eltze, Charlotte Bunne, Magdalena B&uuml;scher, Jan Gleixner, Max Horn, Anna Huhn, Nils Klughammer, Jakob Kreft, Elisabeth Sch&auml;fer, Carolin Schmelas, Silvan Schmitz, Max Waldha BBa_K1362425 1 BsaI -> BsaI restriction site for RFC[???] cloning (in part in prefix) 2014-10-07T11:00:00Z 2015-05-08T01:10:05Z This Sequence starts with a part of the BsaI recognition site. The missing G of the recognition site can be found in the upstream BB prefix. It contains a spacer nucleotide so that BsaI will cut the top strand directly downstream and the bottom strand 4 nucleotides downstream. false false _1738_ 0 22830 9 Not in stock false false Constantin Ahlmann-Eltze, Charlotte Bunne, Magdalena B&uuml;scher, Jan Gleixner, Max Horn, Anna Huhn, Nils Klughammer, Jakob Kreft, Elisabeth Sch&auml;fer, Carolin Schmelas, Silvan Schmitz, Max Waldha annotation2402282 1 RFC[???] standard overhang A range2402282 1 5 5 annotation2400588 1 BsaI site range2400588 1 1 5 BBa_K1362419 1 RFC105 CC C-terminal splicing overhang CAAC=1/3?+Asn RFC[105] standard overhang CC 2014-10-06T11:00:00Z 2015-05-08T01:10:05Z This standard overhang part was developed as part of the iGEM team Heidelberg 2014's Intein Toolbox [[#References|[1]]]. All standard sequences can be reviewed in RFC[???] [[#References|[2]]]. This is a standard overhang sequence for in-frame cloning of Proteins of Interest in front or behind an Intein. A detailed cloning strategy is found on the iGEM team Heidelberg 2014's [http://2014.igem.org/Team:Heidelberg/parts wiki page] as well as in RFC[???]. Specifically, this part contains the overhang E used to insert a protein in front of an N-Intein. It lies within the four bases formed by the cystein and the first base of the subsequent Leucine/Isoleucine or similar of the N-terminal splicing site. false false _1738_ 0 12377 9 Not in stock false This part is only the sequence of a standard overhang. It will not be sent in as physical DNA and was merely created to easily compose new parts in the RFC[???] standard. In the actual cloning process this sequence was and is recommended to be inserted with the according PCR primers. false Constantin Ahlmann-Eltze, Charlotte Bunne, Magdalena B??scher, Jan Gleixner, Max Horn, Anna Huhn, Nils Klughammer, Jakob Kreft, Elisabeth Sch??fer, Carolin Schmelas, Silvan Schmitz, Max Waldha BBa_K1362423 1 <- BsaI BsaI reverse restriction site for RFC[105] cloning 2014-10-06T11:00:00Z 2015-05-08T01:10:05Z This standard restriction site sequence is used as part of the iGEM team Heidelberg 2014's Intein Toolbox [[#References|[1]]]. All associated standard sequences can be reviewed in RFC[???] This is the reverse complement of a BsaI restriction site headed by an Adenine as a spacer-base to separate the recognition sequence from the outward-lying cutting sequence. It was used by us for scarless golden-gate cloning to fuse inteins to other proteins and thereby implement a variety of possible port-translational modifications. false false _1738_ 0 12377 9 Not in stock false This part is only the sequence of a restriction site. It will not be sent in as physical DNA and was merely created to easily compose new parts in the RFC[???] standard. In the actual cloning process this sequence was and is recommended to be inserted with the according PCR primers. false Constantin Ahlmann-Eltze, Charlotte Bunne, Magdalena B??scher, Jan Gleixner, Max Horn, Anna Huhn, Nils Klughammer, Jakob Kreft, Elisabeth Sch??fer, Carolin Schmelas, Silvan Schmitz, Max Waldha BBa_K1362425_sequence 1 gtctcc BBa_K1362426_sequence 1 tgtc BBa_K1362419_sequence 1 caac BBa_K1362423_sequence 1 agagacc BBa_K1362433_sequence 1 tgctgggaa BBa_K1362438_sequence 1 ggaggaggt BBa_K1362054_sequence 1 gtctcccaactgctgggaaggaggaggtgctgctaacgacgaaaactacgctctggctgcttaatagagacctgtc BBa_K1362421_sequence 1 taat BBa_M0050_sequence 1 gctgctaacgacgaaaactacgctctggctgct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z