BBa_K1362090 1 T7 RBS strong T7 RBS 2014-10-02T11:00:00Z 2015-05-08T01:10:04Z synthesized as found in the T7 genome and several commercial expression plasmids. RFC10 compatible strong RBS derived from the T7 phage gene 10a (major capsid protein)[1]. When assembled to a coding part with the A of the start codon being part of the XbaI site, the RBS will be shifted one bp downstream compared to the native sequence. The sequence was successfully used by the iGEM team Heidelberg 2014 for the expression of many proteins in E.coli. 1. Olinss, P. & Rangwala, S. H. Derived from Bacteriophage T7 mRNA Acts ELS an Enhancer of Translation of the lac2 Gene in. 16973???16976 (1989). false false _1738_ 0 22830 9 It's complicated false The 18 bp including the XbaI that can be found upstream of the presumably important part of the RBS were included into the sequence just to make sure it works. However to fully comply with RFC10 a G was inserted behind the XbaI site. false Constantin Ahlmann-Eltze, Charlotte Bunne, Magdalena B??scher, Jan Gleixner, Max Horn, Anna Huhn, Nils Klughammer, Jakob Kreft, Elisabeth Sch??fer, Carolin Schmelas, Silvan Schmitz, Max Waldha annotation2393795 1 t7 RBS range2393795 1 11 28 annotation2393796 1 Shine-Dalgarno range2393796 1 21 28 BBa_J70594 1 BBa_J70594 RFC12 TAATAA Tail Domain 2010-06-17T11:00:00Z 2015-05-08T01:08:25Z Common Knowledge A RFC12 compatible part that simply codes for two stop codons. This part does not have any degradation tag. false true _41_ 0 6384 41 Not in stock false Made with synthetic oligos: 5' AATTC GCGGCGC T ACTAGT TAATAA GCTAGC A GCGGCCG CTGCA 3' 5' GCGGCCGCTGCTAGC TTATTA ACTAGTAGCGCCGC G 3' Note that both primers were ordered phosphorylated. An alternative is to phosphorylate the primers yourself with a kinase. false Joseph Lynch annotation2071257 1 stop range2071257 1 1 5 BBa_K1362470 1 BBa_K1362470 sfGFP_T65C sequence (Mutated <partinfo>BBa_I746917</partinfo>) 2014-10-08T11:00:00Z 2015-05-08T01:10:06Z Comes from part: <partinfo>BBa_I746917</partinfo> This is a mutated version of superfolder GFP <partinfo>BBa_I746917</partinfo> the T at position 65 has been mutated to a C. This mutation was inserted to serve as a control for the intein splicing reaction tested with the iGEM team Heidelberg 2014's split fluorescent protein assay. false false _1738_ 0 12377 9 Not in stock false This is only the raw sequence. Is was used in BBa_K1362170 which is a translational unit for mutated superfolder GFP. false Jakob Kreft BBa_K1362170 1 sfGFP_T65C Split sfGFP reconstitution positive control 2014-10-08T11:00:00Z 2015-05-08T01:10:05Z ??? ??? false false _1738_ 0 12377 9 In stock false ??? false Constantin Ahlmann-Eltze, Charlotte Bunne, Magdalena Buescher, Jan Gleixner, Max Horn, Anna Huhn, Nils Klughammer, Jakob Kreft, Elisabeth Schaefer, Carolin Schmelas, Silvan Schmitz, Max Waldhauer component2414464 1 BBa_J70594 component2414456 1 BBa_K1362090 component2414457 1 BBa_G0000 component2414459 1 BBa_K371056 component2414460 1 BBa_K1362468 component2414462 1 BBa_K1362468 component2414461 1 BBa_K1362470 annotation2414459 1 BBa_K371056 range2414459 1 36 38 annotation2414456 1 BBa_K1362090 range2414456 1 1 29 annotation2414464 1 BBa_J70594 range2414464 1 786 791 annotation2414460 1 BBa_K1362468 range2414460 1 39 56 annotation2414462 1 BBa_K1362468 range2414462 1 768 785 annotation2414457 1 BBa_G0000 range2414457 1 30 35 annotation2414461 1 BBa_K1362470 range2414461 1 57 767 BBa_K1362468 1 BBa_K1362468 hexahistidine-tag 2014-10-08T11:00:00Z 2015-05-08T01:10:06Z Sequence was assembled from the codon usage table http://www.genscript.com/cgi-bin/tools/codon_freq_table . A Hexahistidine-tag for protein purification or detection on western blots. false false _1738_ 0 12377 9 Not in stock false none false Jakob Kreft BBa_K371056 1 BBa_K371056 ATG 2010-11-05T12:00:00Z 2015-05-08T01:12:16Z ATG ATG false false _498_ 0 3908 9 Not in stock false ATG false Hao Jiang annotation2113878 1 start codon range2113878 1 1 3 BBa_G0000 1 scar SpeI/XbaI scar for RBS-CDS junctions 2007-07-22T11:00:00Z 2015-08-31T04:07:27Z SpeI/XbaI scar This is the sequence of the SpeI/XbaI scar for RBS-CDS junctions in BioBricks standard assembly. false true _41_ 0 126 162 Not in stock false This is a shorter scar to ensure proper spacing between the RBS and CDS. false Reshma Shetty BBa_K1362470_sequence 1 cgtaaaggcgaagagctgttcactggtgtcgtccctattctggtggaactggatggtgatgtcaacggtcataagttttccgtgcgtggcgagggtgaaggtgacgcaactaatggtaaactgacgctgaagttcatctgtactactggtaaactgccggtaccttggccgactctggtaacgacgctgtgttatggtgttcagtgctttgctcgttatccggaccatatgaagcagcatgacttcttcaagtccgccatgccggaaggctatgtgcaggaacgcacgatttcctttaaggatgacggcacgtacaaaacgcgtgcggaagtgaaatttgaaggcgataccctggtaaaccgcattgagctgaaaggcattgactttaaagaagacggcaatatcctgggccataagctggaatacaattttaacagccacaatgtttacatcaccgccgataaacaaaaaaatggcattaaagcgaattttaaaattcgccacaacgtggaggatggcagcgtgcagctggctgatcactaccagcaaaacactccaatcggtgatggtcctgttctgctgccagacaatcactatctgagcacgcaaagcgttctgtctaaagatccgaacgagaaacgcgatcatatggttctgctggagttcgtaaccgcagcgggcatcacgcatggtatggatgaactgtacaaa BBa_J70594_sequence 1 taataa BBa_K1362170_sequence 1 aataattttgtttaactttaagaaggagatactagatgcaccaccaccaccaccaccgtaaaggcgaagagctgttcactggtgtcgtccctattctggtggaactggatggtgatgtcaacggtcataagttttccgtgcgtggcgagggtgaaggtgacgcaactaatggtaaactgacgctgaagttcatctgtactactggtaaactgccggtaccttggccgactctggtaacgacgctgtgttatggtgttcagtgctttgctcgttatccggaccatatgaagcagcatgacttcttcaagtccgccatgccggaaggctatgtgcaggaacgcacgatttcctttaaggatgacggcacgtacaaaacgcgtgcggaagtgaaatttgaaggcgataccctggtaaaccgcattgagctgaaaggcattgactttaaagaagacggcaatatcctgggccataagctggaatacaattttaacagccacaatgtttacatcaccgccgataaacaaaaaaatggcattaaagcgaattttaaaattcgccacaacgtggaggatggcagcgtgcagctggctgatcactaccagcaaaacactccaatcggtgatggtcctgttctgctgccagacaatcactatctgagcacgcaaagcgttctgtctaaagatccgaacgagaaacgcgatcatatggttctgctggagttcgtaaccgcagcgggcatcacgcatggtatggatgaactgtacaaacaccaccaccaccaccactaataa BBa_G0000_sequence 1 tactag BBa_K1362090_sequence 1 aataattttgtttaactttaagaaggaga BBa_K371056_sequence 1 atg BBa_K1362468_sequence 1 caccaccaccaccaccac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z