BBa_K371056 1 BBa_K371056 ATG 2010-11-05T12:00:00Z 2015-05-08T01:12:16Z ATG ATG false false _498_ 0 3908 9 Not in stock false ATG false Hao Jiang annotation2113878 1 start codon range2113878 1 1 3 BBa_J18909 1 HisTag His tag (6xHis; E. coli - optimized) 2010-01-15T12:00:00Z 2015-08-31T04:08:35Z Synthetic DNA Hexahistidine affinity tag. Binds zinc, nickel, or cobalt affinity resins. =Notes= This part is identical to BBa_I757013 (which does not seem to be available though). =References= Wikipedia article: [http://en.wikipedia.org/wiki/Polyhistidine-tag] false false _165_ 0 2175 165 It's complicated false Simple repetition of the His codon most frequent in E. coli -- a more balanced codon-choice may be better. false Raik Gruenberg annotation2065463 1 PolyHis range2065463 1 1 18 BBa_K1362479 1 NpuDnaE(C) nonsplicing NpuDnaE C-Intein cloning piece 2014-10-09T11:00:00Z 2015-05-08T01:10:06Z Mutated part of the of Npu DnaE C-intein sequence missing in [[BBa_K1362401]]. false false _1738_ 0 22830 9 Not in stock false false Jan Gleixner BBa_K1362472 1 sfGFP(C)-H split sfGFPc half 2014-10-08T11:00:00Z 2015-05-08T01:10:06Z ??? ??? false false _1738_ 0 12377 9 Not in stock false ??? false Constantin Ahlmann-Eltze, Charlotte Bunne, Magdalena B??scher, Jan Gleixner, Max Horn, Anna Huhn, Nils Klughammer, Jakob Kreft, Elisabeth Sch??fer, Carolin Schmelas, Silvan Schmitz, Max Waldha annotation2414292 1 His6 range2414292 1 523 540 annotation2414294 1 sfGFP(65-238) range2414294 1 1 522 annotation2414291 1 stop range2414291 1 541 546 BBa_K1362090 1 T7 RBS strong T7 RBS 2014-10-02T11:00:00Z 2015-05-08T01:10:04Z synthesized as found in the T7 genome and several commercial expression plasmids. RFC10 compatible strong RBS derived from the T7 phage gene 10a (major capsid protein)[1]. When assembled to a coding part with the A of the start codon being part of the XbaI site, the RBS will be shifted one bp downstream compared to the native sequence. The sequence was successfully used by the iGEM team Heidelberg 2014 for the expression of many proteins in E.coli. 1. Olinss, P. & Rangwala, S. H. Derived from Bacteriophage T7 mRNA Acts ELS an Enhancer of Translation of the lac2 Gene in. 16973???16976 (1989). false false _1738_ 0 22830 9 It's complicated false The 18 bp including the XbaI that can be found upstream of the presumably important part of the RBS were included into the sequence just to make sure it works. However to fully comply with RFC10 a G was inserted behind the XbaI site. false Constantin Ahlmann-Eltze, Charlotte Bunne, Magdalena B??scher, Jan Gleixner, Max Horn, Anna Huhn, Nils Klughammer, Jakob Kreft, Elisabeth Sch??fer, Carolin Schmelas, Silvan Schmitz, Max Waldha annotation2393795 1 t7 RBS range2393795 1 11 28 annotation2393796 1 Shine-Dalgarno range2393796 1 21 28 BBa_K1362172 1 BBa_K1362172 Split sfGFP reconstitution C-terminal non-splicing control half 2014-10-09T11:00:00Z 2015-05-08T01:10:05Z ??? ??? false false _1738_ 0 12377 9 In stock false ??? false Constantin Ahlmann-Eltze, Charlotte Bunne, Magdalena Buescher, Jan Gleixner, Max Horn, Anna Huhn, Nils Klughammer, Jakob Kreft, Elisabeth Schaefer, Carolin Schmelas, Silvan Schmitz, Max Waldhauer component2414564 1 BBa_G0000 component2414563 1 BBa_K1362090 component2414566 1 BBa_K371056 component2414568 1 BBa_J18909 component2414569 1 BBa_K1362479 component2414573 1 BBa_K1362472 annotation2414569 1 BBa_K1362479 range2414569 1 57 161 annotation2414566 1 BBa_K371056 range2414566 1 36 38 annotation2414573 1 BBa_K1362472 range2414573 1 162 707 annotation2414564 1 BBa_G0000 range2414564 1 30 35 annotation2414563 1 BBa_K1362090 range2414563 1 1 29 annotation2414568 1 BBa_J18909 range2414568 1 39 56 BBa_G0000 1 scar SpeI/XbaI scar for RBS-CDS junctions 2007-07-22T11:00:00Z 2015-08-31T04:07:27Z SpeI/XbaI scar This is the sequence of the SpeI/XbaI scar for RBS-CDS junctions in BioBricks standard assembly. false true _41_ 0 126 162 Not in stock false This is a shorter scar to ensure proper spacing between the RBS and CDS. false Reshma Shetty BBa_K1362172_sequence 1 aataattttgtttaactttaagaaggagatactagatgcatcatcatcatcatcatatcaaaatagccacacgtaaatatttaggcaaacaaaatgtctatgacattggagttgagcgcgaccataattttgcactcaaaaatggcttcatagctgctggttgctatggtgttcagtgctttgctcgttatccggaccatatgaagcagcatgacttcttcaagtccgccatgccggaaggctatgtgcaggaacgcacgatttcctttaaggatgacggcacgtacaaaacgcgtgcggaagtgaaatttgaaggcgataccctggtaaaccgcattgagctgaaaggcattgactttaaagaagacggcaatatcctgggccataagctggaatacaattttaacagccacaatgtttacatcaccgccgataaacaaaaaaatggcattaaagcgaattttaaaattcgccacaacgtggaggatggcagcgtgcagctggctgatcactaccagcaaaacactccaatcggtgatggtcctgttctgctgccagacaatcactatctgagcacgcaaagcgttctgtctaaagatccgaacgagaaacgcgatcatatggttctgctggagttcgtaaccgcagcgggcatcacgcatggtatggatgaactgtacaaacaccaccaccaccaccactaataa BBa_J18909_sequence 1 catcatcatcatcatcat BBa_K1362472_sequence 1 tgctatggtgttcagtgctttgctcgttatccggaccatatgaagcagcatgacttcttcaagtccgccatgccggaaggctatgtgcaggaacgcacgatttcctttaaggatgacggcacgtacaaaacgcgtgcggaagtgaaatttgaaggcgataccctggtaaaccgcattgagctgaaaggcattgactttaaagaagacggcaatatcctgggccataagctggaatacaattttaacagccacaatgtttacatcaccgccgataaacaaaaaaatggcattaaagcgaattttaaaattcgccacaacgtggaggatggcagcgtgcagctggctgatcactaccagcaaaacactccaatcggtgatggtcctgttctgctgccagacaatcactatctgagcacgcaaagcgttctgtctaaagatccgaacgagaaacgcgatcatatggttctgctggagttcgtaaccgcagcgggcatcacgcatggtatggatgaactgtacaaacaccaccaccaccaccactaataa BBa_G0000_sequence 1 tactag BBa_K1362479_sequence 1 atcaaaatagccacacgtaaatatttaggcaaacaaaatgtctatgacattggagttgagcgcgaccataattttgcactcaaaaatggcttcatagctgctggt BBa_K1362090_sequence 1 aataattttgtttaactttaagaaggaga BBa_K371056_sequence 1 atg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z