BBa_K1362471 1 H6-sfGFP(N split sfGFPn half 2014-10-08T11:00:00Z 2015-05-08T01:10:06Z ??? ??? false false _1738_ 0 12377 9 Not in stock false ??? false Jakob Kreft annotation2414078 1 start range2414078 1 1 3 annotation2414299 1 His6 range2414299 1 4 21 annotation2414077 1 sfGFP(2-64) range2414077 1 22 210 BBa_J70594 1 BBa_J70594 RFC12 TAATAA Tail Domain 2010-06-17T11:00:00Z 2015-05-08T01:08:25Z Common Knowledge A RFC12 compatible part that simply codes for two stop codons. This part does not have any degradation tag. false true _41_ 0 6384 41 Not in stock false Made with synthetic oligos: 5' AATTC GCGGCGC T ACTAGT TAATAA GCTAGC A GCGGCCG CTGCA 3' 5' GCGGCCGCTGCTAGC TTATTA ACTAGTAGCGCCGC G 3' Note that both primers were ordered phosphorylated. An alternative is to phosphorylate the primers yourself with a kinase. false Joseph Lynch annotation2071257 1 stop range2071257 1 1 5 BBa_K1362400 1 NpuDnaE(N) NpuDnaE N-Intein cloning piece 2014-10-05T11:00:00Z 2015-05-08T01:10:05Z Obtained from pVS07 by Prof. Henning D. Mootz, University of Muenster. Nostoc punctiforme DnaE split Intein N-terminal half. This is a DNA piece for cloning used to assemble other BioBrick parts. false false _1738_ 0 12377 9 Not in stock false This part represents only the intein sequence without inluding the standard splicing-site or polyglycine-linker overhangs. false Constantin Ahlmann-Eltze, Charlotte Bunne, Magdalena Büscher, Jan Gleixner, Max Horn, Anna Huhn, Nils Klughammer, Jakob Kreft, Elisabeth Schäfer, Carolin Schmelas, Silvan Schmitz, Max Waldha BBa_K1362475 1 Cys+1/3Ile TGTT=Cys+1/3Leu 2014-10-09T11:00:00Z 2015-05-08T01:10:06Z false false _1738_ 0 22830 9 Not in stock false false Jan Gleixner BBa_K1362090 1 T7 RBS strong T7 RBS 2014-10-02T11:00:00Z 2015-05-08T01:10:04Z synthesized as found in the T7 genome and several commercial expression plasmids. RFC10 compatible strong RBS derived from the T7 phage gene 10a (major capsid protein)[1]. When assembled to a coding part with the A of the start codon being part of the XbaI site, the RBS will be shifted one bp downstream compared to the native sequence. The sequence was successfully used by the iGEM team Heidelberg 2014 for the expression of many proteins in E.coli. 1. Olinss, P. & Rangwala, S. H. Derived from Bacteriophage T7 mRNA Acts ELS an Enhancer of Translation of the lac2 Gene in. 16973???16976 (1989). false false _1738_ 0 22830 9 It's complicated false The 18 bp including the XbaI that can be found upstream of the presumably important part of the RBS were included into the sequence just to make sure it works. However to fully comply with RFC10 a G was inserted behind the XbaI site. false Constantin Ahlmann-Eltze, Charlotte Bunne, Magdalena B??scher, Jan Gleixner, Max Horn, Anna Huhn, Nils Klughammer, Jakob Kreft, Elisabeth Sch??fer, Carolin Schmelas, Silvan Schmitz, Max Waldha annotation2393796 1 Shine-Dalgarno range2393796 1 21 28 annotation2393795 1 t7 RBS range2393795 1 11 28 BBa_G0000 1 scar SpeI/XbaI scar for RBS-CDS junctions 2007-07-22T11:00:00Z 2015-08-31T04:07:27Z SpeI/XbaI scar This is the sequence of the SpeI/XbaI scar for RBS-CDS junctions in BioBricks standard assembly. false true _41_ 0 126 162 Not in stock false This is a shorter scar to ensure proper spacing between the RBS and CDS. false Reshma Shetty BBa_J18909 1 HisTag His tag (6xHis; E. coli - optimized) 2010-01-15T12:00:00Z 2015-08-31T04:08:35Z Synthetic DNA Hexahistidine affinity tag. Binds zinc, nickel, or cobalt affinity resins. =Notes= This part is identical to BBa_I757013 (which does not seem to be available though). =References= Wikipedia article: [http://en.wikipedia.org/wiki/Polyhistidine-tag] false false _165_ 0 2175 165 It's complicated false Simple repetition of the His codon most frequent in E. coli -- a more balanced codon-choice may be better. false Raik Gruenberg annotation2065463 1 PolyHis range2065463 1 1 18 BBa_K1362173 1 BBa_K1362173 Split sfGFP reconstitution N-terminal splicing half 2014-10-09T11:00:00Z 2015-05-08T01:10:05Z false false _1738_ 0 22830 9 In stock false false Constantin Ahlmann-Eltze, Charlotte Bunne, Magdalena Buescher, Jan Gleixner, Max Horn, Anna Huhn, Nils Klughammer, Jakob Kreft, Elisabeth Schaefer, Carolin Schmelas, Silvan Schmitz, Max Waldhauer component2414345 1 BBa_G0000 component2414351 1 BBa_K1362400 component2414344 1 BBa_K1362090 component2414353 1 BBa_J18909 component2414355 1 BBa_J70594 component2414350 1 BBa_K1362475 component2414349 1 BBa_K1362471 annotation2414344 1 BBa_K1362090 range2414344 1 1 29 annotation2414349 1 BBa_K1362471 range2414349 1 36 245 annotation2414351 1 BBa_K1362400 range2414351 1 250 551 annotation2414345 1 BBa_G0000 range2414345 1 30 35 annotation2414355 1 BBa_J70594 range2414355 1 570 575 annotation2414350 1 BBa_K1362475 range2414350 1 246 249 annotation2414353 1 BBa_J18909 range2414353 1 552 569 BBa_K1362173_sequence 1 aataattttgtttaactttaagaaggagatactagatgcaccaccaccaccaccaccgtaaaggcgaagagctgttcactggtgtcgtccctattctggtggaactggatggtgatgtcaacggtcataagttttccgtgcgtggcgagggtgaaggtgacgcaactaatggtaaactgacgctgaagttcatctgtactactggtaaactgccggtaccttggccgactctggtaacgacgctgtgtttaagctatgaaacggaaatattgacagtagaatatggattattaccgattggtaaaattgtagaaaagcgcatcgaatgtactgtttatagcgttgataataatggaaatatttatacacaacctgtagcacaatggcacgatcgcggagaacaagaggtgtttgagtattgtttggaagatggttcattgattcgggcaacaaaagaccataagtttatgactgttgatggtcaaatgttgccaattgatgaaatatttgaacgtgaattggatttgatgcgggttgataatttgccgaatcatcatcatcatcatcattaataa BBa_K1362475_sequence 1 tgtt BBa_J70594_sequence 1 taataa BBa_J18909_sequence 1 catcatcatcatcatcat BBa_G0000_sequence 1 tactag BBa_K1362400_sequence 1 taagctatgaaacggaaatattgacagtagaatatggattattaccgattggtaaaattgtagaaaagcgcatcgaatgtactgtttatagcgttgataataatggaaatatttatacacaacctgtagcacaatggcacgatcgcggagaacaagaggtgtttgagtattgtttggaagatggttcattgattcgggcaacaaaagaccataagtttatgactgttgatggtcaaatgttgccaattgatgaaatatttgaacgtgaattggatttgatgcgggttgataatttgccgaat BBa_K1362090_sequence 1 aataattttgtttaactttaagaaggaga BBa_K1362471_sequence 1 atgcaccaccaccaccaccaccgtaaaggcgaagagctgttcactggtgtcgtccctattctggtggaactggatggtgatgtcaacggtcataagttttccgtgcgtggcgagggtgaaggtgacgcaactaatggtaaactgacgctgaagttcatctgtactactggtaaactgccggtaccttggccgactctggtaacgacgctg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z