BBa_K1362402 1 SspDnaX(N) SspDnaX N-Intein cloning piece 2014-10-05T11:00:00Z 2015-05-08T01:10:05Z Part was obtained by DNA synthesis. Synechocystis species DnaX-S11 split Intein N-terminal half. This is a DNA piece for cloning used to assemble other BioBrick parts. false false _1738_ 0 12377 9 Not in stock false This part represents only the intein sequence without inluding the standard splicing-site or polyglycine-linker overhangs. false Constantin Ahlmann-Eltze, Charlotte Bunne, Magdalena Büscher, Jan Gleixner, Max Horn, Anna Huhn, Nils Klughammer, Jakob Kreft, Elisabeth Schäfer, Carolin Schmelas, Silvan Schmitz, Max Waldha BBa_K1362402_sequence 1 taaccggcgacagccaggttctgacccgtaacggtctgatgtctattgacaacccgcagattaagggtcgcgaagtactgagctacaacgaaactttacagcagtgggagtataaaaaagttctgcgttggctggaccgtggcgaaaaacagactctgtccatcaaaaccaagaactctactgtgcgttgcaccgcgaaccatctgatccgcactgaacagggctggactcgtgccgaaaacattaccccgggtatgaagatcctgagccctccgcagtggcatacgaacttcgaggaagtagaatctgtcacgaagggtcaggtcgaaaaagtatatgacctggaagtagaagacaaccacaacttcgttgcaaac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z