BBa_K1362412 1 Gp41-1(N) Gp41-1 N-Intein cloning piece 2014-10-05T11:00:00Z 2015-05-08T01:10:05Z Part information and data come from Schmidt et al. [[#References|[1]]]. The sequence was acquired from Pietrokovski et al. [[#References|[1]]] (Supplementary data: http://nar.oxfordjournals.org/content/suppl/2009/02/25/gkp095.DC1/nar-00060-s-2009-File008.pdf). Part DNA was obtained by DNA synthesis. Gp41-1 split Intein N-terminal half. This is a DNA piece for cloning used to assemble other BioBrick parts. false false _1738_ 0 12377 9 Not in stock false This part represents only the intein sequence without including the standard splicing-site or polyglycine-linker overhangs. false Constantin Ahlmann-Eltze, Charlotte Bunne, Magdalena Büscher, Jan Gleixner, Max Horn, Anna Huhn, Nils Klughammer, Jakob Kreft, Elisabeth Schäfer, Carolin Schmelas, Silvan Schmitz, Max Waldha BBa_K1362412_sequence 1 tggatctgaaaacccaggttcagaccccgcagggtatgaaggaaatttccaacatccaggtcggtgatctggtactgagcaacacgggttacaacgaagttctgaacgtcttcccgaaatctaaaaaaaagtcttacaaaatcaccctggaagatggcaaggaaatcatctgttccgaagaacacctgtttccgacgcagactggtgaaatgaacatctccggtggtctgaaagaaggtatgtgtctgtatgttaaagaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z