BBa_K1362479 1 NpuDnaE(C) nonsplicing NpuDnaE C-Intein cloning piece 2014-10-09T11:00:00Z 2015-05-08T01:10:06Z Mutated part of the of Npu DnaE C-intein sequence missing in [[BBa_K1362401]]. false false _1738_ 0 22830 9 Not in stock false false Jan Gleixner BBa_K1362479_sequence 1 atcaaaatagccacacgtaaatatttaggcaaacaaaatgtctatgacattggagttgagcgcgaccataattttgcactcaaaaatggcttcatagctgctggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z