BBa_K1362900 1 3xSWAG(N) N-terminal tripleSWAGtag (N-intein) 2014-10-07T11:00:00Z 2015-05-08T01:10:06Z The SWAG CDS was extracted from my genome where it occurs in high quantities and in an extremely repetitive pattern. SWAG-tags are commonly used to increase the SWAG of proteins. Introducing an even stronger polySWAG-tagging system combined with post-translational intein-splicing we offer you a great tool to easily maximize the SWAG of any protein of interest even after translation. false false _1738_ 0 12377 9 Not in stock false During the design process it was a the utmost concern to achieve greatest SWAG. The sequence was therefore codon-optimised for E.Coli K12. false Jakob Kreft BBa_K1362900_sequence 1 tcttgggcgggttcttgggcgggttcttgggcgggtggtggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z