BBa_K1363000 1 BBa_K1363000 DgrA the receptor of c-di-GMP 2014-09-28T11:00:00Z 2015-05-08T01:10:06Z It comes from the genome of Caulobacter crescentus. The DgrA is a protein which firstly be discovered in the G- bacteria Caulobacter crescentus.It is a receptor of c-di-GMP and its function is to inhibit the movement of flagellum.We use it to inhibit the movement of the flagellum of Caulobacter crescentus when it recepts the illumination to let the bacteria adhere in time. false false _1739_ 0 18849 9 It's complicated false The sequence of DgrA doesn't contain any standrad restriction site. false Bo Dong BBa_K1363000_sequence 1 aaagaggagaaaatggtcatggtcgagacctcgggcgctgagcggcgcgcgcatccccggatgccggcggcgcggaaaatctacatcgtagacgacccgcggtcgtggaaggcctctctgctggacgtcgccgagaagggcgggcggatctccatcgcgggcatcgcttcaccgccggacaccttcgtgttcgtggacgccggcggtcggcgtgttcatctcgccaacgtcgtctggcgctccgggaccgaggtcggggtccagttcgccgccacccaacggatcgggcctcgggcgggcggcgccgccggagcgcttgagatcgcgcgtcggtttctcgctactttgccggccgaagacgacgcctagagcgcctttcgatt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z